Incidental Mutation 'R2130:Fgf17'
ID227993
Institutional Source Beutler Lab
Gene Symbol Fgf17
Ensembl Gene ENSMUSG00000022101
Gene Namefibroblast growth factor 17
Synonyms
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70636203-70642268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70638487 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 102 (R102G)
Ref Sequence ENSEMBL: ENSMUSP00000154684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022695] [ENSMUST00000022697] [ENSMUST00000227123] [ENSMUST00000228295]
Predicted Effect probably benign
Transcript: ENSMUST00000022695
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022697
AA Change: R113G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022697
Gene: ENSMUSG00000022101
AA Change: R113G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 51 178 1.66e-41 SMART
low complexity region 203 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227123
AA Change: R102G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228295
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibroblast growth factor (FGF) family. Member of the FGF family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is expressed during embryogenesis and in the adult cerebellum and cortex and may be essential for vascular growth and normal brain development. Mutations in this gene are the cause of hypogonadotropic hypogonadism 20 with or without anosmia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal at birth and apparently healthy at birth. However, there are tissue losses in the inferior colliculus and the anterior vermis of the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Fgf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Fgf17 APN 14 70636980 missense probably damaging 1.00
IGL02319:Fgf17 APN 14 70636743 missense possibly damaging 0.92
IGL02519:Fgf17 APN 14 70638528 missense probably damaging 0.99
IGL02563:Fgf17 APN 14 70636738 nonsense probably null
R0148:Fgf17 UTSW 14 70638873 missense probably damaging 1.00
R0487:Fgf17 UTSW 14 70638556 missense probably damaging 1.00
R1386:Fgf17 UTSW 14 70636770 missense probably damaging 0.96
R2133:Fgf17 UTSW 14 70638487 missense probably damaging 0.98
R4033:Fgf17 UTSW 14 70641526 splice site probably benign
R4255:Fgf17 UTSW 14 70641722 critical splice donor site probably null
R5503:Fgf17 UTSW 14 70636968 missense probably damaging 1.00
R6924:Fgf17 UTSW 14 70641541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGACCTCGTCCTGTCAG -3'
(R):5'- AGCTACCTAGTCTAGTCCCTGG -3'

Sequencing Primer
(F):5'- TCGTCCTGTCAGGCTGGAG -3'
(R):5'- AGGAAGCCTCTTGATGCTGC -3'
Posted On2014-09-17