Incidental Mutation 'R2131:Mest'
ID228072
Institutional Source Beutler Lab
Gene Symbol Mest
Ensembl Gene ENSMUSG00000051855
Gene Namemesoderm specific transcript
SynonymsPeg1
MMRRC Submission 040134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2131 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30723547-30748465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30745885 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 269 (L269F)
Ref Sequence ENSEMBL: ENSMUSP00000129639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000115127] [ENSMUST00000124665] [ENSMUST00000147400] [ENSMUST00000151777] [ENSMUST00000157040] [ENSMUST00000163949] [ENSMUST00000166192]
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083567
Predicted Effect probably benign
Transcript: ENSMUST00000115127
SMART Domains Protein: ENSMUSP00000110780
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 23 107 3e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124665
AA Change: L276F
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855
AA Change: L276F

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137521
Predicted Effect probably benign
Transcript: ENSMUST00000147400
SMART Domains Protein: ENSMUSP00000120408
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
Pfam:DUF1057 35 144 3.3e-9 PFAM
Pfam:Abhydrolase_6 64 145 3.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149496
Predicted Effect probably benign
Transcript: ENSMUST00000151777
SMART Domains Protein: ENSMUSP00000115541
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 42 133 1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000157040
AA Change: L260F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855
AA Change: L260F

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163949
AA Change: L269F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855
AA Change: L269F

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166192
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retardation of embryonic growth and subtle cardiac abnormalities associated with reduced postnatal survival rates. Mutant females exhibit abnormal maternal behavior and impaired placentophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
4931408C20Rik T C 1: 26,685,854 R82G probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Acvr2b A G 9: 119,432,808 R437G probably damaging Het
Adamtsl3 C A 7: 82,578,594 A1329E probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adra1a A T 14: 66,727,532 I324F possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Ampd1 G T 3: 103,094,878 probably null Het
Ankrd16 T A 2: 11,783,695 D211E probably damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Arap2 T C 5: 62,677,958 N747S probably damaging Het
Arsk A T 13: 76,091,812 C47* probably null Het
Atp8b5 T A 4: 43,370,726 F1001I probably benign Het
Bap1 T A 14: 31,258,331 Y645* probably null Het
Brca2 A G 5: 150,557,129 Y2760C probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Cdkn2c A C 4: 109,665,063 N28K probably null Het
Celsr1 T A 15: 85,963,223 I1438F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cldn1 G C 16: 26,371,550 A26G probably damaging Het
Col20a1 T A 2: 180,992,573 F110L probably damaging Het
Creg2 T C 1: 39,624,978 N204S probably benign Het
Cx3cl1 C A 8: 94,779,573 Q69K probably benign Het
Cyfip2 T C 11: 46,286,131 E74G possibly damaging Het
Cyp2g1 A T 7: 26,820,710 I456F probably damaging Het
Dapk1 A G 13: 60,729,531 E528G possibly damaging Het
Dapk1 T A 13: 60,761,667 W1365R possibly damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Depdc5 T A 5: 32,990,781 L1469* probably null Het
Dnah3 T A 7: 119,967,759 T2415S possibly damaging Het
Dnmbp A G 19: 43,854,311 L1210S probably damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Fam171b T A 2: 83,879,858 S625T probably damaging Het
Fam186a T C 15: 99,933,676 probably benign Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Gabra4 G T 5: 71,641,224 D137E probably benign Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm43302 T C 5: 105,274,744 D474G probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr19 T C 6: 134,870,442 M1V probably null Het
Hnf4a T A 2: 163,547,418 N29K probably benign Het
Htt A G 5: 34,877,109 R1975G possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Il4i1 G A 7: 44,840,070 V420M probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd4 A T 11: 59,454,955 H287L probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Kdm5d T C Y: 941,483 L1228P probably benign Het
Klra3 A G 6: 130,335,775 S9P probably benign Het
Ldhd C T 8: 111,628,537 probably null Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmo7 A T 14: 101,900,238 D670V probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lrp5 T C 19: 3,622,708 T534A possibly damaging Het
Lrrc24 A T 15: 76,715,581 F453I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Med4 A G 14: 73,517,996 N248S possibly damaging Het
Mib2 C T 4: 155,655,238 probably null Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Nbr1 T A 11: 101,566,191 probably null Het
Ncapd3 T G 9: 27,083,346 V1174G probably damaging Het
Nyap1 A C 5: 137,733,681 probably null Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr775 T C 10: 129,251,074 F180S probably benign Het
Oosp1 T C 19: 11,690,950 D23G probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Otog A T 7: 46,250,100 N275I probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pcx T C 19: 4,602,551 F189L probably benign Het
Pde6b A G 5: 108,428,203 D718G probably damaging Het
Pklr C A 3: 89,142,660 P314Q probably damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Plekho1 A G 3: 95,989,117 S347P probably damaging Het
Plxna2 G A 1: 194,644,750 D331N probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkra A T 2: 76,647,136 I75K probably damaging Het
Ptpn11 G A 5: 121,172,026 A31V probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Sarm1 A T 11: 78,475,307 C649S probably benign Het
Sept12 T A 16: 4,991,779 Q223L probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc22a21 A T 11: 53,979,733 L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 probably null Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spag6 T A 2: 18,733,097 C259* probably null Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Stk24 A T 14: 121,302,211 I191N probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tacc2 T A 7: 130,621,857 S91T possibly damaging Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tbccd1 A G 16: 22,841,989 S26P probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tor1aip2 A G 1: 156,065,349 Y467C probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Tti1 T C 2: 158,000,743 R789G probably benign Het
Ttn A T 2: 76,832,217 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2cbp A T 9: 86,372,487 probably null Het
Vav2 C A 2: 27,299,396 R176L possibly damaging Het
Wdr27 T A 17: 14,928,332 D133V probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp467 A C 6: 48,442,661 S38A probably damaging Het
Other mutations in Mest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mest APN 6 30746331 unclassified probably benign
IGL02231:Mest APN 6 30740773 missense possibly damaging 0.93
IGL02386:Mest APN 6 30744914 missense possibly damaging 0.94
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0826:Mest UTSW 6 30742814 missense probably damaging 1.00
R0972:Mest UTSW 6 30740684 nonsense probably null
R1580:Mest UTSW 6 30745823 unclassified probably benign
R1768:Mest UTSW 6 30745139 missense probably benign 0.01
R1835:Mest UTSW 6 30742791 missense probably benign 0.14
R3918:Mest UTSW 6 30742750 missense probably benign 0.07
R3919:Mest UTSW 6 30742750 missense probably benign 0.07
R4544:Mest UTSW 6 30740680 missense probably damaging 1.00
R4546:Mest UTSW 6 30740680 missense probably damaging 1.00
R4647:Mest UTSW 6 30745110 nonsense probably null
R6818:Mest UTSW 6 30746287 missense probably damaging 1.00
R7048:Mest UTSW 6 30742724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTCACGTGCTGACATG -3'
(R):5'- GCAAGTCAGTCTTCTAAATGGAACG -3'

Sequencing Primer
(F):5'- CACGTGCTGACATGGGTGG -3'
(R):5'- TCTTCTAAATGGAACGAAGAGGCC -3'
Posted On2014-09-17