Incidental Mutation 'R2131:Ift20'
ID228110
Institutional Source Beutler Lab
Gene Symbol Ift20
Ensembl Gene ENSMUSG00000001105
Gene Nameintraflagellar transport 20
Synonyms
MMRRC Submission 040134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2131 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78536361-78541737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78540034 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 68 (E68K)
Ref Sequence ENSEMBL: ENSMUSP00000118015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017759] [ENSMUST00000050366] [ENSMUST00000103242] [ENSMUST00000108275] [ENSMUST00000108277] [ENSMUST00000128788]
Predicted Effect probably benign
Transcript: ENSMUST00000017759
SMART Domains Protein: ENSMUSP00000017759
Gene: ENSMUSG00000017615

DomainStartEndE-ValueType
BTB 28 128 4.8e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050366
AA Change: E68K

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051699
Gene: ENSMUSG00000001105
AA Change: E68K

DomainStartEndE-ValueType
Pfam:IFT20 9 111 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103242
SMART Domains Protein: ENSMUSP00000099532
Gene: ENSMUSG00000037278

DomainStartEndE-ValueType
Pfam:DUF2781 11 164 1.4e-51 PFAM
low complexity region 166 176 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108275
AA Change: E68K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103910
Gene: ENSMUSG00000001105
AA Change: E68K

DomainStartEndE-ValueType
Pfam:IFT20 10 128 9.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108277
SMART Domains Protein: ENSMUSP00000103912
Gene: ENSMUSG00000017615

DomainStartEndE-ValueType
BTB 28 128 4.8e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128788
AA Change: E68K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118015
Gene: ENSMUSG00000001105
AA Change: E68K

DomainStartEndE-ValueType
Pfam:IFT20 9 128 1.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152016
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a intraflagellar transport protein important for intracellular transport. The encoded protein forms part of a complex involved in trafficking of proteins from the Golgi body, including recycling of immune signalling components (Finetti et al., PubMed: 19855387). This gene is part of a complex set of sense-antisense loci that may be co-regulated. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 14.[provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation die before birth. Mice with conditional loss in renal collecting ducts lack primary cilia and develop renal cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
4931408C20Rik T C 1: 26,685,854 R82G probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Acvr2b A G 9: 119,432,808 R437G probably damaging Het
Adamtsl3 C A 7: 82,578,594 A1329E probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adra1a A T 14: 66,727,532 I324F possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Ampd1 G T 3: 103,094,878 probably null Het
Ankrd16 T A 2: 11,783,695 D211E probably damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Arap2 T C 5: 62,677,958 N747S probably damaging Het
Arsk A T 13: 76,091,812 C47* probably null Het
Atp8b5 T A 4: 43,370,726 F1001I probably benign Het
Bap1 T A 14: 31,258,331 Y645* probably null Het
Brca2 A G 5: 150,557,129 Y2760C probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Cdkn2c A C 4: 109,665,063 N28K probably null Het
Celsr1 T A 15: 85,963,223 I1438F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cldn1 G C 16: 26,371,550 A26G probably damaging Het
Col20a1 T A 2: 180,992,573 F110L probably damaging Het
Creg2 T C 1: 39,624,978 N204S probably benign Het
Cx3cl1 C A 8: 94,779,573 Q69K probably benign Het
Cyfip2 T C 11: 46,286,131 E74G possibly damaging Het
Cyp2g1 A T 7: 26,820,710 I456F probably damaging Het
Dapk1 A G 13: 60,729,531 E528G possibly damaging Het
Dapk1 T A 13: 60,761,667 W1365R possibly damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Depdc5 T A 5: 32,990,781 L1469* probably null Het
Dnah3 T A 7: 119,967,759 T2415S possibly damaging Het
Dnmbp A G 19: 43,854,311 L1210S probably damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Fam171b T A 2: 83,879,858 S625T probably damaging Het
Fam186a T C 15: 99,933,676 probably benign Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Gabra4 G T 5: 71,641,224 D137E probably benign Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm43302 T C 5: 105,274,744 D474G probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr19 T C 6: 134,870,442 M1V probably null Het
Hnf4a T A 2: 163,547,418 N29K probably benign Het
Htt A G 5: 34,877,109 R1975G possibly damaging Het
Il4i1 G A 7: 44,840,070 V420M probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd4 A T 11: 59,454,955 H287L probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Kdm5d T C Y: 941,483 L1228P probably benign Het
Klra3 A G 6: 130,335,775 S9P probably benign Het
Ldhd C T 8: 111,628,537 probably null Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmo7 A T 14: 101,900,238 D670V probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lrp5 T C 19: 3,622,708 T534A possibly damaging Het
Lrrc24 A T 15: 76,715,581 F453I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Med4 A G 14: 73,517,996 N248S possibly damaging Het
Mest C T 6: 30,745,885 L269F probably damaging Het
Mib2 C T 4: 155,655,238 probably null Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Nbr1 T A 11: 101,566,191 probably null Het
Ncapd3 T G 9: 27,083,346 V1174G probably damaging Het
Nyap1 A C 5: 137,733,681 probably null Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr775 T C 10: 129,251,074 F180S probably benign Het
Oosp1 T C 19: 11,690,950 D23G probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Otog A T 7: 46,250,100 N275I probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pcx T C 19: 4,602,551 F189L probably benign Het
Pde6b A G 5: 108,428,203 D718G probably damaging Het
Pklr C A 3: 89,142,660 P314Q probably damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Plekho1 A G 3: 95,989,117 S347P probably damaging Het
Plxna2 G A 1: 194,644,750 D331N probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkra A T 2: 76,647,136 I75K probably damaging Het
Ptpn11 G A 5: 121,172,026 A31V probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Sarm1 A T 11: 78,475,307 C649S probably benign Het
Sept12 T A 16: 4,991,779 Q223L probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc22a21 A T 11: 53,979,733 L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 probably null Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spag6 T A 2: 18,733,097 C259* probably null Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Stk24 A T 14: 121,302,211 I191N probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tacc2 T A 7: 130,621,857 S91T possibly damaging Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tbccd1 A G 16: 22,841,989 S26P probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tor1aip2 A G 1: 156,065,349 Y467C probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Tti1 T C 2: 158,000,743 R789G probably benign Het
Ttn A T 2: 76,832,217 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2cbp A T 9: 86,372,487 probably null Het
Vav2 C A 2: 27,299,396 R176L possibly damaging Het
Wdr27 T A 17: 14,928,332 D133V probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp467 A C 6: 48,442,661 S38A probably damaging Het
Other mutations in Ift20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Ift20 APN 11 78539954 splice site probably benign
R1762:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R1783:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R1784:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R1785:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R1786:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R1859:Ift20 UTSW 11 78540034 nonsense probably null
R1930:Ift20 UTSW 11 78540004 missense possibly damaging 0.55
R2004:Ift20 UTSW 11 78540971 missense probably damaging 0.99
R2133:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R2140:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R2141:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R2142:Ift20 UTSW 11 78540034 missense probably damaging 1.00
R5909:Ift20 UTSW 11 78540041 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGTGAGCATTGGACAGCCAC -3'
(R):5'- GCAATGACAAGCATGGACTG -3'

Sequencing Primer
(F):5'- CAACACAATTTAGGTGTGGTTAGCTC -3'
(R):5'- GGTTCAGTTATGCAAGCACC -3'
Posted On2014-09-17