Incidental Mutation 'R2056:Kdm5b'
ID228151
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134613214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 681 (D681E)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
PDB Structure
Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
AA Change: D681E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: D681E

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
AA Change: D681E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: D681E

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTTGGACAAGTAGAATAATGTGC -3'
(R):5'- TGATTGGATGCTTTCCCAAAGG -3'

Sequencing Primer
(F):5'- TCTGTCTTCAGATACGCTAGAAGAGG -3'
(R):5'- CAAACAAGTAGGCCAGGT -3'
Posted On2014-09-17