Incidental Mutation 'R2057:Crb1'
ID228230
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 040062-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R2057 (G1)
Quality Score124
Status Not validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139314750 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 330 (Y330C)
Ref Sequence ENSEMBL: ENSMUSP00000142702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445] [ENSMUST00000200340]
Predicted Effect probably damaging
Transcript: ENSMUST00000059825
AA Change: Y330C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: Y330C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196402
AA Change: Y330C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681
AA Change: Y330C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197035
AA Change: I40M
Predicted Effect probably benign
Transcript: ENSMUST00000198445
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200340
SMART Domains Protein: ENSMUSP00000142909
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
EGF_CA 12 49 5.15e-8 SMART
EGF 54 88 1.47e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCTGCTATAAAACACAGGGAATC -3'
(R):5'- TGCTACTAGAATCTGCTTCCATGTAG -3'

Sequencing Primer
(F):5'- TCACCTGTGAATCCAGGCTGAC -3'
(R):5'- AGAATCTGCTTCCATGTAGTATCCTG -3'
Posted On2014-09-17