Incidental Mutation 'R2057:Tmem176b'
ID228253
Institutional Source Beutler Lab
Gene Symbol Tmem176b
Ensembl Gene ENSMUSG00000029810
Gene Nametransmembrane protein 176B
Synonyms1810009M01Rik, Clast1, Lr8
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48833818-48841496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48836333 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000144742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101429] [ENSMUST00000164733] [ENSMUST00000166247] [ENSMUST00000203229] [ENSMUST00000203265] [ENSMUST00000203355] [ENSMUST00000203501] [ENSMUST00000204073] [ENSMUST00000204400] [ENSMUST00000204783] [ENSMUST00000205147] [ENSMUST00000205159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101429
AA Change: T64I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098972
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164733
AA Change: T64I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128705
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166247
AA Change: T64I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131064
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203229
AA Change: T64I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144865
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203265
AA Change: T64I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144869
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 194 2.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203355
AA Change: T64I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145395
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203501
AA Change: T64I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144742
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 170 3.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203618
Predicted Effect possibly damaging
Transcript: ENSMUST00000204073
AA Change: T64I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144864
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204400
Predicted Effect probably benign
Transcript: ENSMUST00000204783
SMART Domains Protein: ENSMUSP00000144810
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 1 58 1.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205147
AA Change: T64I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145235
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205159
AA Change: T64I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144949
Gene: ENSMUSG00000029810
AA Change: T64I

DomainStartEndE-ValueType
Pfam:CD20 60 196 1.2e-35 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit severe sporadic ataxia and a small cerebellum associated with abnormal cerebellar lobulation, loss of the internal granule cell layer, poor formation of the external germinal layer, and disorganized Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Tmem176b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Tmem176b APN 6 48834070 missense possibly damaging 0.79
IGL02374:Tmem176b APN 6 48834626 missense possibly damaging 0.60
IGL03027:Tmem176b APN 6 48835639 missense probably damaging 1.00
IGL03134:Tmem176b UTSW 6 48838353 missense probably benign 0.00
R1634:Tmem176b UTSW 6 48834566 missense probably damaging 1.00
R1920:Tmem176b UTSW 6 48838204 missense possibly damaging 0.70
R2008:Tmem176b UTSW 6 48835449 missense probably damaging 0.97
R2056:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2059:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R5099:Tmem176b UTSW 6 48834529 missense probably benign
R5484:Tmem176b UTSW 6 48834533 missense probably benign 0.01
R5623:Tmem176b UTSW 6 48834070 missense probably benign 0.14
R6102:Tmem176b UTSW 6 48835934 missense probably benign 0.30
R6413:Tmem176b UTSW 6 48838332 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCAGAAGGGTTCTCTCCAGC -3'
(R):5'- CTGGCAGAAATCGATGACATTAGG -3'

Sequencing Primer
(F):5'- GTTCTCTCCAGCCCCCAGG -3'
(R):5'- CAGATAGGTGGAGAGCAACGC -3'
Posted On2014-09-17