Incidental Mutation 'R2057:Olfr59'
ID228284
Institutional Source Beutler Lab
Gene Symbol Olfr59
Ensembl Gene ENSMUSG00000070374
Gene Nameolfactory receptor 59
SynonymsMOR133-3P, IH3, GA_x6K02T2P1NL-4434429-4435400
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74283736-74291608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74288826 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000148959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143976] [ENSMUST00000205790] [ENSMUST00000206659] [ENSMUST00000214048]
Predicted Effect probably damaging
Transcript: ENSMUST00000119717
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112522
Gene: ENSMUSG00000070374
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 2.2e-59 PFAM
Pfam:7tm_1 41 292 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143976
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119877
Gene: ENSMUSG00000070374
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_1 41 237 7.5e-34 PFAM
Pfam:7tm_4 139 237 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205790
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206659
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214048
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Olfr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr59 APN 11 74289126 missense probably damaging 1.00
IGL00337:Olfr59 APN 11 74289387 missense probably damaging 0.97
IGL01307:Olfr59 APN 11 74289428 missense possibly damaging 0.88
IGL01488:Olfr59 APN 11 74288688 missense probably damaging 1.00
IGL02583:Olfr59 APN 11 74289504 missense probably damaging 1.00
IGL02839:Olfr59 APN 11 74289370 nonsense probably null
IGL02996:Olfr59 APN 11 74289165 missense probably benign 0.08
R0013:Olfr59 UTSW 11 74289051 missense possibly damaging 0.88
R0077:Olfr59 UTSW 11 74288675 missense probably benign 0.00
R0078:Olfr59 UTSW 11 74289266 missense probably damaging 1.00
R0734:Olfr59 UTSW 11 74288946 missense probably damaging 1.00
R1033:Olfr59 UTSW 11 74288666 missense probably damaging 0.99
R1556:Olfr59 UTSW 11 74288936 missense probably damaging 1.00
R1721:Olfr59 UTSW 11 74289300 missense probably damaging 1.00
R1737:Olfr59 UTSW 11 74288811 missense probably damaging 1.00
R1848:Olfr59 UTSW 11 74289213 missense probably damaging 0.99
R1881:Olfr59 UTSW 11 74288666 missense probably benign 0.08
R2107:Olfr59 UTSW 11 74289390 missense probably damaging 1.00
R4399:Olfr59 UTSW 11 74288856 missense probably damaging 1.00
R4633:Olfr59 UTSW 11 74289294 missense probably benign 0.00
R5593:Olfr59 UTSW 11 74288792 missense possibly damaging 0.65
R5988:Olfr59 UTSW 11 74288853 missense probably benign
R6104:Olfr59 UTSW 11 74289366 missense probably damaging 1.00
R7436:Olfr59 UTSW 11 74288685 missense possibly damaging 0.84
Z1088:Olfr59 UTSW 11 74288835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTCATGGCAAGAGGAAACC -3'
(R):5'- TCCTATAGTGGAGAGGGTGAC -3'

Sequencing Primer
(F):5'- CAGACCAGCACCTTTGAGTTC -3'
(R):5'- CTACAAAGCGGTCATAGGCCATTG -3'
Posted On2014-09-17