Incidental Mutation 'R2058:Jak3'
ID228377
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission 040063-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R2058 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 71685383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000051995
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110012
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110013
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,672,066 probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Arhgef4 A G 1: 34,722,377 K238R unknown Het
Atf6b A T 17: 34,648,575 probably null Het
Atp2a1 G A 7: 126,447,672 A847V possibly damaging Het
Baz1b T A 5: 135,217,225 N509K probably benign Het
BC051076 A T 5: 87,963,985 noncoding transcript Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Cd302 T A 2: 60,252,423 I186F possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Col4a1 T A 8: 11,210,792 D1330V probably damaging Het
Ctsa T G 2: 164,834,902 M136R probably null Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Gcc2 T A 10: 58,285,957 S1102T probably benign Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gna14 G C 19: 16,608,141 probably benign Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gulo A G 14: 65,991,159 V270A possibly damaging Het
Hps5 T A 7: 46,768,051 D904V probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Klhl6 T G 16: 19,982,931 T25P probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Map3k21 A G 8: 125,938,722 K550R probably benign Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msh5 A C 17: 35,029,756 V738G probably damaging Het
Mybph G A 1: 134,200,119 C473Y probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Notch3 T C 17: 32,143,644 T1336A probably benign Het
Nsun4 T C 4: 116,053,680 probably null Het
Olfr1023 A T 2: 85,886,952 T51S possibly damaging Het
Olfr390 A G 11: 73,787,274 N112S probably benign Het
Osgin1 A G 8: 119,445,673 D402G possibly damaging Het
Patl1 A G 19: 11,932,147 E479G possibly damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pcdhb13 A G 18: 37,444,567 Q666R possibly damaging Het
Pi4k2b G A 5: 52,750,680 V131I probably benign Het
Pkn2 G A 3: 142,853,471 H98Y possibly damaging Het
Pms1 A G 1: 53,275,168 Y73H probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prl6a1 T C 13: 27,319,098 Y231H probably benign Het
Ranbp3l T A 15: 9,000,817 V41D probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Ripk4 A T 16: 97,744,142 L372* probably null Het
Rnf126 A G 10: 79,759,137 probably benign Het
S100pbp A G 4: 129,182,100 V144A probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Sap25 G A 5: 137,642,772 G277R probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Set A G 2: 30,069,036 K70E possibly damaging Het
Setd3 A G 12: 108,107,341 I559T probably benign Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Skint3 A T 4: 112,255,783 K197* probably null Het
Skint5 T A 4: 113,870,700 I402F possibly damaging Het
Slc18a1 G A 8: 69,043,961 T350M probably damaging Het
Slc19a3 A T 1: 83,014,791 I403K probably damaging Het
Slc1a7 C T 4: 108,004,439 T225I probably benign Het
Slc38a4 T C 15: 97,008,725 I336V probably benign Het
Smarcc1 A G 9: 110,118,343 probably benign Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Strc A T 2: 121,378,887 W290R probably damaging Het
Svep1 T C 4: 58,084,554 D1858G possibly damaging Het
Sympk G A 7: 19,043,529 R568Q probably damaging Het
Tex44 A C 1: 86,427,006 K212N probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thrap3 C T 4: 126,180,174 V260I probably damaging Het
Thsd7a A T 6: 12,318,106 probably benign Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Vmn2r113 T A 17: 22,958,249 L669* probably null Het
Vps13b T A 15: 35,841,447 V2541E probably damaging Het
Wnt3 T C 11: 103,812,285 I198T probably damaging Het
Zfp316 T C 5: 143,263,406 E158G unknown Het
Zfp362 T G 4: 128,786,987 I182L possibly damaging Het
Zfp804a A G 2: 82,257,366 D513G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Zfp97 T A 17: 17,144,756 N172K possibly damaging Het
Zmym6 A T 4: 127,088,415 K82* probably null Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCCCGCCCTAGATTAC -3'
(R):5'- CCCGGTACTTGACGATGAAG -3'

Sequencing Primer
(F):5'- TAGATTACGAGCTCCTCTCAGAC -3'
(R):5'- AGTCGCTGTGCAGAGCCTTAAG -3'
Posted On2014-09-17