Incidental Mutation 'R2058:Smarcc1'
ID228382
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission 040063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2058 (G1)
Quality Score196
Status Validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 110118343 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098355] [ENSMUST00000111991] [ENSMUST00000165596] [ENSMUST00000196171] [ENSMUST00000196497] [ENSMUST00000197182] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000199529] [ENSMUST00000199835] [ENSMUST00000200066] [ENSMUST00000200476]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082943
Predicted Effect probably benign
Transcript: ENSMUST00000098355
SMART Domains Protein: ENSMUSP00000095958
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 62 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111991
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165596
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196171
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196497
SMART Domains Protein: ENSMUSP00000143529
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
PDB:2DB2|A 67 101 5e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196828
Predicted Effect probably benign
Transcript: ENSMUST00000197182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197785
Predicted Effect probably benign
Transcript: ENSMUST00000197928
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197979
Predicted Effect probably benign
Transcript: ENSMUST00000198425
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198843
Predicted Effect probably benign
Transcript: ENSMUST00000199529
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199801
Predicted Effect probably benign
Transcript: ENSMUST00000199835
SMART Domains Protein: ENSMUSP00000142636
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
PDB:2DB2|A 67 171 3e-68 PDB
SCOP:d1di2a_ 76 145 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200066
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200476
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,672,066 probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Arhgef4 A G 1: 34,722,377 K238R unknown Het
Atf6b A T 17: 34,648,575 probably null Het
Atp2a1 G A 7: 126,447,672 A847V possibly damaging Het
Baz1b T A 5: 135,217,225 N509K probably benign Het
BC051076 A T 5: 87,963,985 noncoding transcript Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Cd302 T A 2: 60,252,423 I186F possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Col4a1 T A 8: 11,210,792 D1330V probably damaging Het
Ctsa T G 2: 164,834,902 M136R probably null Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Gcc2 T A 10: 58,285,957 S1102T probably benign Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gna14 G C 19: 16,608,141 probably benign Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gulo A G 14: 65,991,159 V270A possibly damaging Het
Hps5 T A 7: 46,768,051 D904V probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Jak3 A T 8: 71,685,383 probably null Het
Klhl6 T G 16: 19,982,931 T25P probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Map3k21 A G 8: 125,938,722 K550R probably benign Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msh5 A C 17: 35,029,756 V738G probably damaging Het
Mybph G A 1: 134,200,119 C473Y probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Notch3 T C 17: 32,143,644 T1336A probably benign Het
Nsun4 T C 4: 116,053,680 probably null Het
Olfr1023 A T 2: 85,886,952 T51S possibly damaging Het
Olfr390 A G 11: 73,787,274 N112S probably benign Het
Osgin1 A G 8: 119,445,673 D402G possibly damaging Het
Patl1 A G 19: 11,932,147 E479G possibly damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pcdhb13 A G 18: 37,444,567 Q666R possibly damaging Het
Pi4k2b G A 5: 52,750,680 V131I probably benign Het
Pkn2 G A 3: 142,853,471 H98Y possibly damaging Het
Pms1 A G 1: 53,275,168 Y73H probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prl6a1 T C 13: 27,319,098 Y231H probably benign Het
Ranbp3l T A 15: 9,000,817 V41D probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Ripk4 A T 16: 97,744,142 L372* probably null Het
Rnf126 A G 10: 79,759,137 probably benign Het
S100pbp A G 4: 129,182,100 V144A probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Sap25 G A 5: 137,642,772 G277R probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Set A G 2: 30,069,036 K70E possibly damaging Het
Setd3 A G 12: 108,107,341 I559T probably benign Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Skint3 A T 4: 112,255,783 K197* probably null Het
Skint5 T A 4: 113,870,700 I402F possibly damaging Het
Slc18a1 G A 8: 69,043,961 T350M probably damaging Het
Slc19a3 A T 1: 83,014,791 I403K probably damaging Het
Slc1a7 C T 4: 108,004,439 T225I probably benign Het
Slc38a4 T C 15: 97,008,725 I336V probably benign Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Strc A T 2: 121,378,887 W290R probably damaging Het
Svep1 T C 4: 58,084,554 D1858G possibly damaging Het
Sympk G A 7: 19,043,529 R568Q probably damaging Het
Tex44 A C 1: 86,427,006 K212N probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thrap3 C T 4: 126,180,174 V260I probably damaging Het
Thsd7a A T 6: 12,318,106 probably benign Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Vmn2r113 T A 17: 22,958,249 L669* probably null Het
Vps13b T A 15: 35,841,447 V2541E probably damaging Het
Wnt3 T C 11: 103,812,285 I198T probably damaging Het
Zfp316 T C 5: 143,263,406 E158G unknown Het
Zfp362 T G 4: 128,786,987 I182L possibly damaging Het
Zfp804a A G 2: 82,257,366 D513G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Zfp97 T A 17: 17,144,756 N172K possibly damaging Het
Zmym6 A T 4: 127,088,415 K82* probably null Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110237808 splice site probably null
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2175:Smarcc1 UTSW 9 110164809 missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110196320 missense probably damaging 1.00
R7068:Smarcc1 UTSW 9 110185884 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGGGCAGTAGTTCACAGCTG -3'
(R):5'- CTGAAGTCACCTGTGCTGTG -3'

Sequencing Primer
(F):5'- GACAATATTTGAGGATGTGCCC -3'
(R):5'- CAGTGGTTATGAACACTTGCC -3'
Posted On2014-09-17