Incidental Mutation 'R2059:Shroom3'
ID228448
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission 040064-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2059 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92683784 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 40 (T40S)
Ref Sequence ENSEMBL: ENSMUSP00000108678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: T40S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: T40S

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168878
AA Change: T40S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: T40S

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Adgrf3 G A 5: 30,199,491 H316Y possibly damaging Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ak5 T A 3: 152,660,637 L42F probably damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Als2cl T C 9: 110,885,438 V118A probably benign Het
Ano1 G C 7: 144,611,390 L641V probably damaging Het
Arfgef1 C T 1: 10,188,752 probably null Het
Atf6b A T 17: 34,648,575 probably null Het
Atf7ip T G 6: 136,609,348 probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Baz2a T A 10: 128,113,578 S347R probably damaging Het
C2cd3 T C 7: 100,455,493 probably benign Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Cdh12 T A 15: 21,583,740 N555K probably benign Het
Cenpj G A 14: 56,563,955 P187L possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cfap54 A T 10: 92,942,979 probably benign Het
Cgref1 T G 5: 30,933,645 D275A possibly damaging Het
Clgn A C 8: 83,399,978 N103H probably benign Het
Corin A G 5: 72,316,051 V905A possibly damaging Het
Csta1 A C 16: 36,122,322 D72E probably benign Het
Cul5 A T 9: 53,667,156 L44Q probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dync1i2 G A 2: 71,249,853 probably null Het
Enoph1 A G 5: 100,059,219 D55G probably damaging Het
Fam160b2 A G 14: 70,585,049 V744A possibly damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Foxi2 G T 7: 135,410,677 G98V probably damaging Het
Galr2 T C 11: 116,282,939 S132P probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gm15446 C T 5: 109,942,496 H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 I153N probably benign Het
Grip1 A G 10: 120,038,698 K789R possibly damaging Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Herc2 T A 7: 56,163,897 H2625Q probably damaging Het
Hoxc9 A G 15: 102,984,123 D256G probably benign Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Irf2 A T 8: 46,807,345 N104I probably damaging Het
Kat6a A G 8: 22,939,305 N1559D possibly damaging Het
Kcnq4 G T 4: 120,698,002 F661L probably benign Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Khdrbs1 T C 4: 129,725,721 E209G probably damaging Het
Lama3 A T 18: 12,528,333 R2116S probably damaging Het
Mir124-2hg C A 3: 17,785,713 E65* probably null Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msl3l2 T A 10: 56,115,944 L255Q probably damaging Het
Mx1 T A 16: 97,454,179 K225* probably null Het
Nf1 T C 11: 79,556,723 V435A probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Nop2 T A 6: 125,139,860 M359K probably null Het
Nox1 T C X: 134,095,244 probably benign Het
Ogdhl G A 14: 32,332,884 R263K probably damaging Het
Olfr1388 T A 11: 49,444,451 V200E probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prl3a1 A G 13: 27,270,144 D35G probably benign Het
Ptprk T A 10: 28,566,603 I893N probably damaging Het
Ptprz1 T C 6: 22,986,323 probably benign Het
Rab3c A G 13: 110,260,516 V72A probably damaging Het
Rbms2 A G 10: 128,137,518 S251P probably benign Het
Rfwd3 A G 8: 111,297,495 V65A probably benign Het
Rps6kl1 T A 12: 85,139,623 Y211F probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Scg3 T C 9: 75,665,716 D311G probably damaging Het
Sdk2 C A 11: 113,854,332 M712I probably damaging Het
Serinc2 T G 4: 130,260,785 Y158S probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc7a3 A G X: 101,080,767 V464A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spata13 A C 14: 60,759,591 I1165L possibly damaging Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Stat5b A T 11: 100,787,332 S652T probably benign Het
Stom A G 2: 35,316,025 S231P probably damaging Het
Sult1b1 A G 5: 87,535,033 Y18H probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem87a A T 2: 120,369,292 I457N probably damaging Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Ush2a T G 1: 188,381,549 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Ust A G 10: 8,207,566 Y349H probably damaging Het
V1rd19 A T 7: 24,003,834 M242L probably benign Het
Vmn1r33 T A 6: 66,612,202 M123L probably benign Het
Vps13c A T 9: 67,860,833 K111N probably damaging Het
Vwa3a A G 7: 120,758,949 D81G probably damaging Het
Zfp318 G A 17: 46,397,024 R336Q probably damaging Het
Zfp609 A G 9: 65,704,434 S416P possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCGATCTAACCCAGCAG -3'
(R):5'- TGCAGTTCAGGCAACGAAC -3'

Sequencing Primer
(F):5'- AGCAGGGAAGCTCCTCTTG -3'
(R):5'- CAGGCAACGAACAGGATTTTTC -3'
Posted On2014-09-17