Incidental Mutation 'R2059:Nlrp9a'
ID228459
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 040064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2059 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26557362 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 46 (I46K)
Ref Sequence ENSEMBL: ENSMUSP00000120498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071780
AA Change: I135K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102
AA Change: I135K

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108387
AA Change: I135K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: I135K

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117252
AA Change: I135K

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102
AA Change: I135K

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122040
AA Change: I135K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102
AA Change: I135K

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143149
Predicted Effect possibly damaging
Transcript: ENSMUST00000153452
AA Change: I46K

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102
AA Change: I46K

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Adgrf3 G A 5: 30,199,491 H316Y possibly damaging Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ak5 T A 3: 152,660,637 L42F probably damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Als2cl T C 9: 110,885,438 V118A probably benign Het
Ano1 G C 7: 144,611,390 L641V probably damaging Het
Arfgef1 C T 1: 10,188,752 probably null Het
Atf6b A T 17: 34,648,575 probably null Het
Atf7ip T G 6: 136,609,348 probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Baz2a T A 10: 128,113,578 S347R probably damaging Het
C2cd3 T C 7: 100,455,493 probably benign Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Cdh12 T A 15: 21,583,740 N555K probably benign Het
Cenpj G A 14: 56,563,955 P187L possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cfap54 A T 10: 92,942,979 probably benign Het
Cgref1 T G 5: 30,933,645 D275A possibly damaging Het
Clgn A C 8: 83,399,978 N103H probably benign Het
Corin A G 5: 72,316,051 V905A possibly damaging Het
Csta1 A C 16: 36,122,322 D72E probably benign Het
Cul5 A T 9: 53,667,156 L44Q probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dync1i2 G A 2: 71,249,853 probably null Het
Enoph1 A G 5: 100,059,219 D55G probably damaging Het
Fam160b2 A G 14: 70,585,049 V744A possibly damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Foxi2 G T 7: 135,410,677 G98V probably damaging Het
Galr2 T C 11: 116,282,939 S132P probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gm15446 C T 5: 109,942,496 H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 I153N probably benign Het
Grip1 A G 10: 120,038,698 K789R possibly damaging Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Herc2 T A 7: 56,163,897 H2625Q probably damaging Het
Hoxc9 A G 15: 102,984,123 D256G probably benign Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Irf2 A T 8: 46,807,345 N104I probably damaging Het
Kat6a A G 8: 22,939,305 N1559D possibly damaging Het
Kcnq4 G T 4: 120,698,002 F661L probably benign Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Khdrbs1 T C 4: 129,725,721 E209G probably damaging Het
Lama3 A T 18: 12,528,333 R2116S probably damaging Het
Mir124-2hg C A 3: 17,785,713 E65* probably null Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msl3l2 T A 10: 56,115,944 L255Q probably damaging Het
Mx1 T A 16: 97,454,179 K225* probably null Het
Nf1 T C 11: 79,556,723 V435A probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nop2 T A 6: 125,139,860 M359K probably null Het
Nox1 T C X: 134,095,244 probably benign Het
Ogdhl G A 14: 32,332,884 R263K probably damaging Het
Olfr1388 T A 11: 49,444,451 V200E probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prl3a1 A G 13: 27,270,144 D35G probably benign Het
Ptprk T A 10: 28,566,603 I893N probably damaging Het
Ptprz1 T C 6: 22,986,323 probably benign Het
Rab3c A G 13: 110,260,516 V72A probably damaging Het
Rbms2 A G 10: 128,137,518 S251P probably benign Het
Rfwd3 A G 8: 111,297,495 V65A probably benign Het
Rps6kl1 T A 12: 85,139,623 Y211F probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Scg3 T C 9: 75,665,716 D311G probably damaging Het
Sdk2 C A 11: 113,854,332 M712I probably damaging Het
Serinc2 T G 4: 130,260,785 Y158S probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Shroom3 A T 5: 92,683,784 T40S probably damaging Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc7a3 A G X: 101,080,767 V464A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spata13 A C 14: 60,759,591 I1165L possibly damaging Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Stat5b A T 11: 100,787,332 S652T probably benign Het
Stom A G 2: 35,316,025 S231P probably damaging Het
Sult1b1 A G 5: 87,535,033 Y18H probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem87a A T 2: 120,369,292 I457N probably damaging Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Ush2a T G 1: 188,381,549 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Ust A G 10: 8,207,566 Y349H probably damaging Het
V1rd19 A T 7: 24,003,834 M242L probably benign Het
Vmn1r33 T A 6: 66,612,202 M123L probably benign Het
Vps13c A T 9: 67,860,833 K111N probably damaging Het
Vwa3a A G 7: 120,758,949 D81G probably damaging Het
Zfp318 G A 17: 46,397,024 R336Q probably damaging Het
Zfp609 A G 9: 65,704,434 S416P possibly damaging Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26573788 splice site probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0086:Nlrp9a UTSW 7 26558547 missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26560741 missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26571407 missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGAGTATTCTATTCCTAACTGCC -3'
(R):5'- GAAGATTCAGGCAACGTACTTG -3'

Sequencing Primer
(F):5'- GCCCTTTATTCTGATTTTTCAAATCC -3'
(R):5'- TCAGGCAACGTACTTGAGATAAGCTC -3'
Posted On2014-09-17