Incidental Mutation 'R2060:C2cd3'
ID228597
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 040065-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2060 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100454948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 825 (I825T)
Ref Sequence ENSEMBL: ENSMUSP00000113728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: I2056T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: I2056T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: I2056T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: I2056T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119647
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: I825T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: I825T

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184657
Predicted Effect probably benign
Transcript: ENSMUST00000185084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193553
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abca14 G A 7: 120,227,518 W462* probably null Het
Aftph A T 11: 20,692,571 Y821N probably damaging Het
Ahnak A T 19: 9,008,041 M2230L probably benign Het
Arfgap1 T C 2: 180,972,782 F144L probably benign Het
Arid4b C T 13: 14,195,452 R1178C probably damaging Het
Asb8 A T 15: 98,141,373 C49S possibly damaging Het
Baz1b A G 5: 135,205,114 N165S probably damaging Het
BC017158 A G 7: 128,288,331 L176P probably damaging Het
Bod1l A T 5: 41,808,742 I2660N possibly damaging Het
C4b A G 17: 34,736,101 W804R probably damaging Het
Cadm3 A T 1: 173,344,402 D201E probably damaging Het
Cdh17 T C 4: 11,803,982 F552L probably benign Het
Cdh7 G C 1: 110,048,877 A91P probably damaging Het
Cela1 A G 15: 100,675,322 probably null Het
Clk3 T C 9: 57,751,117 Y582C probably damaging Het
Cma1 C T 14: 55,943,698 probably null Het
Ctcfl A G 2: 173,118,506 S95P probably benign Het
Cylc1 C A X: 111,123,123 T391K unknown Het
Cyp3a11 T A 5: 145,855,081 I501L probably benign Het
Cyp3a59 T A 5: 146,104,714 L356Q probably damaging Het
Dcdc2a A C 13: 25,107,710 D226A possibly damaging Het
Dlec1 A C 9: 119,112,086 T235P probably damaging Het
Dnaaf1 G A 8: 119,590,602 R290Q probably benign Het
Dnaaf5 C T 5: 139,178,003 R377W probably damaging Het
Dpep1 T A 8: 123,200,391 V293E probably damaging Het
Drosha T A 15: 12,924,159 V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 I596L possibly damaging Het
Edem1 T A 6: 108,854,287 Y570N probably damaging Het
Edrf1 G T 7: 133,657,129 E9* probably null Het
Enpep T A 3: 129,280,523 N792Y probably benign Het
Enpp2 A T 15: 54,875,714 M391K probably damaging Het
Fanca A C 8: 123,274,481 V1105G probably damaging Het
Fbxo22 T A 9: 55,218,383 L74I probably damaging Het
Fchsd2 T A 7: 101,277,417 F571L probably benign Het
Fhad1 T C 4: 141,899,249 D1345G probably benign Het
G2e3 T C 12: 51,372,606 F702L probably damaging Het
Glce A T 9: 62,060,946 S308T possibly damaging Het
Glt1d1 A G 5: 127,657,119 D119G probably benign Het
Gpr137c T C 14: 45,244,159 I144T probably damaging Het
Gprin3 A G 6: 59,354,519 C268R possibly damaging Het
Hadha G A 5: 30,128,836 T395M probably benign Het
Hdhd2 T G 18: 76,965,042 probably null Het
Homer2 C T 7: 81,618,703 E70K probably benign Het
Hp1bp3 T A 4: 138,240,672 D397E probably damaging Het
Hrh3 T C 2: 180,101,250 N195S possibly damaging Het
Hyou1 T C 9: 44,381,552 V153A probably benign Het
Igf2r A T 17: 12,701,319 S1378T possibly damaging Het
Ints4 G A 7: 97,501,763 R279H possibly damaging Het
Itga10 A T 3: 96,654,998 R699* probably null Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Itsn2 T G 12: 4,627,879 F79V probably damaging Het
Jak3 C A 8: 71,680,714 C350* probably null Het
Jak3 A T 8: 71,683,415 K620* probably null Het
Kcnq5 T C 1: 21,461,597 S421G probably benign Het
Kdm2b A T 5: 122,883,365 M50K probably damaging Het
Klk1b1 A G 7: 43,970,623 D170G possibly damaging Het
Lama3 A T 18: 12,528,726 T2160S probably benign Het
Lman1 A T 18: 65,998,352 probably benign Het
Lmtk3 G A 7: 45,800,911 probably null Het
Ltb A G 17: 35,195,763 R180G probably damaging Het
Ltbp4 C T 7: 27,308,953 R1310Q probably damaging Het
Macf1 T A 4: 123,499,919 probably null Het
Mast4 G T 13: 102,738,846 P1146Q probably damaging Het
Micall2 C T 5: 139,711,562 S678N probably damaging Het
Mon2 A T 10: 122,995,776 I1675N probably damaging Het
Mug2 A G 6: 122,079,612 N1172S probably benign Het
Naa30 C G 14: 49,173,099 S161R possibly damaging Het
Ncaph T C 2: 127,124,875 N220D probably damaging Het
Nell1 T C 7: 50,560,830 V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 N142S possibly damaging Het
Nin T A 12: 70,042,418 T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 noncoding transcript Het
Nrg1 T G 8: 31,918,015 E63D probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1167 T C 2: 88,149,143 Y292C probably damaging Het
Olfr128 A G 17: 37,923,880 T105A probably benign Het
Olfr473 C T 7: 107,933,661 T47M probably benign Het
Olfr522 T A 7: 140,162,824 E42V probably damaging Het
Olfr845 A G 9: 19,339,056 I199V probably benign Het
Olfr851 T A 9: 19,497,237 V163E possibly damaging Het
Olfr867 A T 9: 20,054,596 I289N probably damaging Het
Olfr998 G A 2: 85,591,283 V248I possibly damaging Het
Orc5 C T 5: 22,516,703 probably null Het
Pard3 G A 8: 127,398,604 R691Q probably benign Het
Pofut1 T A 2: 153,243,660 D54E probably benign Het
Prl2c5 T A 13: 13,190,653 V128E probably damaging Het
Ptk7 T C 17: 46,566,238 M965V possibly damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Pzp A T 6: 128,483,710 N1494K probably benign Het
Rad21l A G 2: 151,645,429 V545A probably benign Het
Rps6kc1 A T 1: 190,810,108 M352K possibly damaging Het
Rpusd2 G A 2: 119,037,215 probably null Het
Rsph14 A T 10: 75,029,771 D78E probably damaging Het
Rtl9 A T X: 143,102,030 M813L possibly damaging Het
Rtp4 A T 16: 23,612,940 H74L probably damaging Het
Rusc1 G A 3: 89,087,848 T725I possibly damaging Het
Ryr2 C T 13: 11,595,736 C4068Y probably damaging Het
Ryr3 A G 2: 112,954,364 V224A possibly damaging Het
Shprh A T 10: 11,152,120 N157I probably benign Het
Siglece A G 7: 43,657,786 I67T probably benign Het
Slc9b2 A T 3: 135,326,266 T296S probably damaging Het
Sorbs2 A G 8: 45,775,629 K276E probably damaging Het
Synj2 A G 17: 6,037,480 T1269A probably benign Het
Taar7b T C 10: 24,000,675 I246T possibly damaging Het
Taldo1 A G 7: 141,396,154 Y113C probably damaging Het
Tarbp1 A T 8: 126,447,594 probably null Het
Tars C T 15: 11,394,373 M59I probably benign Het
Tas2r130 G A 6: 131,630,817 T5I probably benign Het
Tex48 T C 4: 63,607,415 E77G probably damaging Het
Tmco5 A G 2: 116,892,255 R286G probably damaging Het
Trdmt1 A T 2: 13,519,914 H243Q probably benign Het
Ttn T A 2: 76,734,294 R26754* probably null Het
Ttn G A 2: 76,897,580 probably benign Het
Ubqln3 A C 7: 104,142,151 L244R probably damaging Het
Ubxn1 C T 19: 8,873,566 R115* probably null Het
Umod T G 7: 119,476,715 N276T probably damaging Het
Unc13c A T 9: 73,665,656 L1528Q probably damaging Het
Unc80 T A 1: 66,640,595 H2108Q possibly damaging Het
Utp20 A C 10: 88,774,795 D1442E probably damaging Het
Utp4 A G 8: 106,898,521 Q144R probably benign Het
Vmn2r17 T A 5: 109,427,209 N127K probably benign Het
Vmn2r75 T A 7: 86,165,164 T374S probably benign Het
Washc5 A G 15: 59,350,408 F523L probably damaging Het
Wdr3 A T 3: 100,159,897 probably null Het
Wdr89 T C 12: 75,632,988 Y164C probably damaging Het
Xpo5 T C 17: 46,225,091 S550P probably damaging Het
Zfp69 T C 4: 120,930,832 T429A probably damaging Het
Zfpm1 G T 8: 122,336,592 G797C probably benign Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATAGAGGCGAGCACAGATTCC -3'
(R):5'- AAACACCACTTTGGCTAGGGG -3'

Sequencing Primer
(F):5'- GAGCACAGATTCCCTGCCTC -3'
(R):5'- CCTGTGCAGGCTGGGGG -3'
Posted On2014-09-17