Incidental Mutation 'R2060:Pard3'
ID228619
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission 040065-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2060 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127398604 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 691 (R691Q)
Ref Sequence ENSEMBL: ENSMUSP00000125450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000108752] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160717] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162176] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602] [ENSMUST00000162907]
Predicted Effect probably benign
Transcript: ENSMUST00000026921
AA Change: R691Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079777
AA Change: R556Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: R556Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108752
AA Change: R556Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104383
Gene: ENSMUSG00000025812
AA Change: R556Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159537
AA Change: R634Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: R634Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160272
AA Change: R691Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160581
AA Change: R681Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: R681Q

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160593
Predicted Effect probably benign
Transcript: ENSMUST00000160717
AA Change: R556Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125612
Gene: ENSMUSG00000025812
AA Change: R556Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160766
AA Change: R634Q

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: R634Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161277
AA Change: R609Q
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: R609Q

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161355
AA Change: R691Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162176
AA Change: R413Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123944
Gene: ENSMUSG00000025812
AA Change: R413Q

DomainStartEndE-ValueType
PDZ 1 83 4.11e-2 SMART
low complexity region 153 162 N/A INTRINSIC
PDZ 191 270 4.1e-20 SMART
PDZ 321 406 9.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162309
AA Change: R691Q

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162456
AA Change: R556Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: R556Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162531
AA Change: R678Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: R678Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162536
AA Change: R647Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: R647Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162602
AA Change: R691Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162665
AA Change: R710Q
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: R710Q

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162727
AA Change: R62Q
SMART Domains Protein: ENSMUSP00000124359
Gene: ENSMUSG00000025812
AA Change: R62Q

DomainStartEndE-ValueType
Blast:PDZ 2 56 8e-30 BLAST
PDB:2KOH|A 2 61 4e-35 PDB
SCOP:d1qaua_ 4 55 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162907
AA Change: R691Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124319
Gene: ENSMUSG00000025812
AA Change: R691Q

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 4.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abca14 G A 7: 120,227,518 W462* probably null Het
Aftph A T 11: 20,692,571 Y821N probably damaging Het
Ahnak A T 19: 9,008,041 M2230L probably benign Het
Arfgap1 T C 2: 180,972,782 F144L probably benign Het
Arid4b C T 13: 14,195,452 R1178C probably damaging Het
Asb8 A T 15: 98,141,373 C49S possibly damaging Het
Baz1b A G 5: 135,205,114 N165S probably damaging Het
BC017158 A G 7: 128,288,331 L176P probably damaging Het
Bod1l A T 5: 41,808,742 I2660N possibly damaging Het
C2cd3 T C 7: 100,454,948 I825T probably damaging Het
C4b A G 17: 34,736,101 W804R probably damaging Het
Cadm3 A T 1: 173,344,402 D201E probably damaging Het
Cdh17 T C 4: 11,803,982 F552L probably benign Het
Cdh7 G C 1: 110,048,877 A91P probably damaging Het
Cela1 A G 15: 100,675,322 probably null Het
Clk3 T C 9: 57,751,117 Y582C probably damaging Het
Cma1 C T 14: 55,943,698 probably null Het
Ctcfl A G 2: 173,118,506 S95P probably benign Het
Cylc1 C A X: 111,123,123 T391K unknown Het
Cyp3a11 T A 5: 145,855,081 I501L probably benign Het
Cyp3a59 T A 5: 146,104,714 L356Q probably damaging Het
Dcdc2a A C 13: 25,107,710 D226A possibly damaging Het
Dlec1 A C 9: 119,112,086 T235P probably damaging Het
Dnaaf1 G A 8: 119,590,602 R290Q probably benign Het
Dnaaf5 C T 5: 139,178,003 R377W probably damaging Het
Dpep1 T A 8: 123,200,391 V293E probably damaging Het
Drosha T A 15: 12,924,159 V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 I596L possibly damaging Het
Edem1 T A 6: 108,854,287 Y570N probably damaging Het
Edrf1 G T 7: 133,657,129 E9* probably null Het
Enpep T A 3: 129,280,523 N792Y probably benign Het
Enpp2 A T 15: 54,875,714 M391K probably damaging Het
Fanca A C 8: 123,274,481 V1105G probably damaging Het
Fbxo22 T A 9: 55,218,383 L74I probably damaging Het
Fchsd2 T A 7: 101,277,417 F571L probably benign Het
Fhad1 T C 4: 141,899,249 D1345G probably benign Het
G2e3 T C 12: 51,372,606 F702L probably damaging Het
Glce A T 9: 62,060,946 S308T possibly damaging Het
Glt1d1 A G 5: 127,657,119 D119G probably benign Het
Gpr137c T C 14: 45,244,159 I144T probably damaging Het
Gprin3 A G 6: 59,354,519 C268R possibly damaging Het
Hadha G A 5: 30,128,836 T395M probably benign Het
Hdhd2 T G 18: 76,965,042 probably null Het
Homer2 C T 7: 81,618,703 E70K probably benign Het
Hp1bp3 T A 4: 138,240,672 D397E probably damaging Het
Hrh3 T C 2: 180,101,250 N195S possibly damaging Het
Hyou1 T C 9: 44,381,552 V153A probably benign Het
Igf2r A T 17: 12,701,319 S1378T possibly damaging Het
Ints4 G A 7: 97,501,763 R279H possibly damaging Het
Itga10 A T 3: 96,654,998 R699* probably null Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Itsn2 T G 12: 4,627,879 F79V probably damaging Het
Jak3 C A 8: 71,680,714 C350* probably null Het
Jak3 A T 8: 71,683,415 K620* probably null Het
Kcnq5 T C 1: 21,461,597 S421G probably benign Het
Kdm2b A T 5: 122,883,365 M50K probably damaging Het
Klk1b1 A G 7: 43,970,623 D170G possibly damaging Het
Lama3 A T 18: 12,528,726 T2160S probably benign Het
Lman1 A T 18: 65,998,352 probably benign Het
Lmtk3 G A 7: 45,800,911 probably null Het
Ltb A G 17: 35,195,763 R180G probably damaging Het
Ltbp4 C T 7: 27,308,953 R1310Q probably damaging Het
Macf1 T A 4: 123,499,919 probably null Het
Mast4 G T 13: 102,738,846 P1146Q probably damaging Het
Micall2 C T 5: 139,711,562 S678N probably damaging Het
Mon2 A T 10: 122,995,776 I1675N probably damaging Het
Mug2 A G 6: 122,079,612 N1172S probably benign Het
Naa30 C G 14: 49,173,099 S161R possibly damaging Het
Ncaph T C 2: 127,124,875 N220D probably damaging Het
Nell1 T C 7: 50,560,830 V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 N142S possibly damaging Het
Nin T A 12: 70,042,418 T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 noncoding transcript Het
Nrg1 T G 8: 31,918,015 E63D probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1167 T C 2: 88,149,143 Y292C probably damaging Het
Olfr128 A G 17: 37,923,880 T105A probably benign Het
Olfr473 C T 7: 107,933,661 T47M probably benign Het
Olfr522 T A 7: 140,162,824 E42V probably damaging Het
Olfr845 A G 9: 19,339,056 I199V probably benign Het
Olfr851 T A 9: 19,497,237 V163E possibly damaging Het
Olfr867 A T 9: 20,054,596 I289N probably damaging Het
Olfr998 G A 2: 85,591,283 V248I possibly damaging Het
Orc5 C T 5: 22,516,703 probably null Het
Pofut1 T A 2: 153,243,660 D54E probably benign Het
Prl2c5 T A 13: 13,190,653 V128E probably damaging Het
Ptk7 T C 17: 46,566,238 M965V possibly damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Pzp A T 6: 128,483,710 N1494K probably benign Het
Rad21l A G 2: 151,645,429 V545A probably benign Het
Rps6kc1 A T 1: 190,810,108 M352K possibly damaging Het
Rpusd2 G A 2: 119,037,215 probably null Het
Rsph14 A T 10: 75,029,771 D78E probably damaging Het
Rtl9 A T X: 143,102,030 M813L possibly damaging Het
Rtp4 A T 16: 23,612,940 H74L probably damaging Het
Rusc1 G A 3: 89,087,848 T725I possibly damaging Het
Ryr2 C T 13: 11,595,736 C4068Y probably damaging Het
Ryr3 A G 2: 112,954,364 V224A possibly damaging Het
Shprh A T 10: 11,152,120 N157I probably benign Het
Siglece A G 7: 43,657,786 I67T probably benign Het
Slc9b2 A T 3: 135,326,266 T296S probably damaging Het
Sorbs2 A G 8: 45,775,629 K276E probably damaging Het
Synj2 A G 17: 6,037,480 T1269A probably benign Het
Taar7b T C 10: 24,000,675 I246T possibly damaging Het
Taldo1 A G 7: 141,396,154 Y113C probably damaging Het
Tarbp1 A T 8: 126,447,594 probably null Het
Tars C T 15: 11,394,373 M59I probably benign Het
Tas2r130 G A 6: 131,630,817 T5I probably benign Het
Tex48 T C 4: 63,607,415 E77G probably damaging Het
Tmco5 A G 2: 116,892,255 R286G probably damaging Het
Trdmt1 A T 2: 13,519,914 H243Q probably benign Het
Ttn T A 2: 76,734,294 R26754* probably null Het
Ttn G A 2: 76,897,580 probably benign Het
Ubqln3 A C 7: 104,142,151 L244R probably damaging Het
Ubxn1 C T 19: 8,873,566 R115* probably null Het
Umod T G 7: 119,476,715 N276T probably damaging Het
Unc13c A T 9: 73,665,656 L1528Q probably damaging Het
Unc80 T A 1: 66,640,595 H2108Q possibly damaging Het
Utp20 A C 10: 88,774,795 D1442E probably damaging Het
Utp4 A G 8: 106,898,521 Q144R probably benign Het
Vmn2r17 T A 5: 109,427,209 N127K probably benign Het
Vmn2r75 T A 7: 86,165,164 T374S probably benign Het
Washc5 A G 15: 59,350,408 F523L probably damaging Het
Wdr3 A T 3: 100,159,897 probably null Het
Wdr89 T C 12: 75,632,988 Y164C probably damaging Het
Xpo5 T C 17: 46,225,091 S550P probably damaging Het
Zfp69 T C 4: 120,930,832 T429A probably damaging Het
Zfpm1 G T 8: 122,336,592 G797C probably benign Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
R7130:Pard3 UTSW 8 127415683 missense probably damaging 1.00
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense not run
R7537:Pard3 UTSW 8 127610582 missense not run
Predicted Primers PCR Primer
(F):5'- CAGAAAGTTGGTCATTAGGCCAAG -3'
(R):5'- TAAGCCCCTCTCCATGAACG -3'

Sequencing Primer
(F):5'- TGGTCATTAGGCCAAGCTGAC -3'
(R):5'- TCTCCATGAACGAGCAGGCTAAG -3'
Posted On2014-09-17