Incidental Mutation 'R2060:Dync2h1'
ID228620
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 040065-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2060 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 7162802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 596 (I596L)
Ref Sequence ENSEMBL: ENSMUSP00000120322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000139115] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139115
AA Change: I596L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120322
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 188 676 3.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147056
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abca14 G A 7: 120,227,518 W462* probably null Het
Aftph A T 11: 20,692,571 Y821N probably damaging Het
Ahnak A T 19: 9,008,041 M2230L probably benign Het
Arfgap1 T C 2: 180,972,782 F144L probably benign Het
Arid4b C T 13: 14,195,452 R1178C probably damaging Het
Asb8 A T 15: 98,141,373 C49S possibly damaging Het
Baz1b A G 5: 135,205,114 N165S probably damaging Het
BC017158 A G 7: 128,288,331 L176P probably damaging Het
Bod1l A T 5: 41,808,742 I2660N possibly damaging Het
C2cd3 T C 7: 100,454,948 I825T probably damaging Het
C4b A G 17: 34,736,101 W804R probably damaging Het
Cadm3 A T 1: 173,344,402 D201E probably damaging Het
Cdh17 T C 4: 11,803,982 F552L probably benign Het
Cdh7 G C 1: 110,048,877 A91P probably damaging Het
Cela1 A G 15: 100,675,322 probably null Het
Clk3 T C 9: 57,751,117 Y582C probably damaging Het
Cma1 C T 14: 55,943,698 probably null Het
Ctcfl A G 2: 173,118,506 S95P probably benign Het
Cylc1 C A X: 111,123,123 T391K unknown Het
Cyp3a11 T A 5: 145,855,081 I501L probably benign Het
Cyp3a59 T A 5: 146,104,714 L356Q probably damaging Het
Dcdc2a A C 13: 25,107,710 D226A possibly damaging Het
Dlec1 A C 9: 119,112,086 T235P probably damaging Het
Dnaaf1 G A 8: 119,590,602 R290Q probably benign Het
Dnaaf5 C T 5: 139,178,003 R377W probably damaging Het
Dpep1 T A 8: 123,200,391 V293E probably damaging Het
Drosha T A 15: 12,924,159 V1209E possibly damaging Het
Edem1 T A 6: 108,854,287 Y570N probably damaging Het
Edrf1 G T 7: 133,657,129 E9* probably null Het
Enpep T A 3: 129,280,523 N792Y probably benign Het
Enpp2 A T 15: 54,875,714 M391K probably damaging Het
Fanca A C 8: 123,274,481 V1105G probably damaging Het
Fbxo22 T A 9: 55,218,383 L74I probably damaging Het
Fchsd2 T A 7: 101,277,417 F571L probably benign Het
Fhad1 T C 4: 141,899,249 D1345G probably benign Het
G2e3 T C 12: 51,372,606 F702L probably damaging Het
Glce A T 9: 62,060,946 S308T possibly damaging Het
Glt1d1 A G 5: 127,657,119 D119G probably benign Het
Gpr137c T C 14: 45,244,159 I144T probably damaging Het
Gprin3 A G 6: 59,354,519 C268R possibly damaging Het
Hadha G A 5: 30,128,836 T395M probably benign Het
Hdhd2 T G 18: 76,965,042 probably null Het
Homer2 C T 7: 81,618,703 E70K probably benign Het
Hp1bp3 T A 4: 138,240,672 D397E probably damaging Het
Hrh3 T C 2: 180,101,250 N195S possibly damaging Het
Hyou1 T C 9: 44,381,552 V153A probably benign Het
Igf2r A T 17: 12,701,319 S1378T possibly damaging Het
Ints4 G A 7: 97,501,763 R279H possibly damaging Het
Itga10 A T 3: 96,654,998 R699* probably null Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Itsn2 T G 12: 4,627,879 F79V probably damaging Het
Jak3 C A 8: 71,680,714 C350* probably null Het
Jak3 A T 8: 71,683,415 K620* probably null Het
Kcnq5 T C 1: 21,461,597 S421G probably benign Het
Kdm2b A T 5: 122,883,365 M50K probably damaging Het
Klk1b1 A G 7: 43,970,623 D170G possibly damaging Het
Lama3 A T 18: 12,528,726 T2160S probably benign Het
Lman1 A T 18: 65,998,352 probably benign Het
Lmtk3 G A 7: 45,800,911 probably null Het
Ltb A G 17: 35,195,763 R180G probably damaging Het
Ltbp4 C T 7: 27,308,953 R1310Q probably damaging Het
Macf1 T A 4: 123,499,919 probably null Het
Mast4 G T 13: 102,738,846 P1146Q probably damaging Het
Micall2 C T 5: 139,711,562 S678N probably damaging Het
Mon2 A T 10: 122,995,776 I1675N probably damaging Het
Mug2 A G 6: 122,079,612 N1172S probably benign Het
Naa30 C G 14: 49,173,099 S161R possibly damaging Het
Ncaph T C 2: 127,124,875 N220D probably damaging Het
Nell1 T C 7: 50,560,830 V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 N142S possibly damaging Het
Nin T A 12: 70,042,418 T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 noncoding transcript Het
Nrg1 T G 8: 31,918,015 E63D probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1167 T C 2: 88,149,143 Y292C probably damaging Het
Olfr128 A G 17: 37,923,880 T105A probably benign Het
Olfr473 C T 7: 107,933,661 T47M probably benign Het
Olfr522 T A 7: 140,162,824 E42V probably damaging Het
Olfr845 A G 9: 19,339,056 I199V probably benign Het
Olfr851 T A 9: 19,497,237 V163E possibly damaging Het
Olfr867 A T 9: 20,054,596 I289N probably damaging Het
Olfr998 G A 2: 85,591,283 V248I possibly damaging Het
Orc5 C T 5: 22,516,703 probably null Het
Pard3 G A 8: 127,398,604 R691Q probably benign Het
Pofut1 T A 2: 153,243,660 D54E probably benign Het
Prl2c5 T A 13: 13,190,653 V128E probably damaging Het
Ptk7 T C 17: 46,566,238 M965V possibly damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Pzp A T 6: 128,483,710 N1494K probably benign Het
Rad21l A G 2: 151,645,429 V545A probably benign Het
Rps6kc1 A T 1: 190,810,108 M352K possibly damaging Het
Rpusd2 G A 2: 119,037,215 probably null Het
Rsph14 A T 10: 75,029,771 D78E probably damaging Het
Rtl9 A T X: 143,102,030 M813L possibly damaging Het
Rtp4 A T 16: 23,612,940 H74L probably damaging Het
Rusc1 G A 3: 89,087,848 T725I possibly damaging Het
Ryr2 C T 13: 11,595,736 C4068Y probably damaging Het
Ryr3 A G 2: 112,954,364 V224A possibly damaging Het
Shprh A T 10: 11,152,120 N157I probably benign Het
Siglece A G 7: 43,657,786 I67T probably benign Het
Slc9b2 A T 3: 135,326,266 T296S probably damaging Het
Sorbs2 A G 8: 45,775,629 K276E probably damaging Het
Synj2 A G 17: 6,037,480 T1269A probably benign Het
Taar7b T C 10: 24,000,675 I246T possibly damaging Het
Taldo1 A G 7: 141,396,154 Y113C probably damaging Het
Tarbp1 A T 8: 126,447,594 probably null Het
Tars C T 15: 11,394,373 M59I probably benign Het
Tas2r130 G A 6: 131,630,817 T5I probably benign Het
Tex48 T C 4: 63,607,415 E77G probably damaging Het
Tmco5 A G 2: 116,892,255 R286G probably damaging Het
Trdmt1 A T 2: 13,519,914 H243Q probably benign Het
Ttn T A 2: 76,734,294 R26754* probably null Het
Ttn G A 2: 76,897,580 probably benign Het
Ubqln3 A C 7: 104,142,151 L244R probably damaging Het
Ubxn1 C T 19: 8,873,566 R115* probably null Het
Umod T G 7: 119,476,715 N276T probably damaging Het
Unc13c A T 9: 73,665,656 L1528Q probably damaging Het
Unc80 T A 1: 66,640,595 H2108Q possibly damaging Het
Utp20 A C 10: 88,774,795 D1442E probably damaging Het
Utp4 A G 8: 106,898,521 Q144R probably benign Het
Vmn2r17 T A 5: 109,427,209 N127K probably benign Het
Vmn2r75 T A 7: 86,165,164 T374S probably benign Het
Washc5 A G 15: 59,350,408 F523L probably damaging Het
Wdr3 A T 3: 100,159,897 probably null Het
Wdr89 T C 12: 75,632,988 Y164C probably damaging Het
Xpo5 T C 17: 46,225,091 S550P probably damaging Het
Zfp69 T C 4: 120,930,832 T429A probably damaging Het
Zfpm1 G T 8: 122,336,592 G797C probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTCCAGTGCTATGCTTG -3'
(R):5'- GTGTAGCTTAAAAGATTCCTCTCTC -3'

Sequencing Primer
(F):5'- CCAGTGCTATGCTTGTCTGC -3'
(R):5'- AGCTTAAAAGATTCCTCTCTCCTCTC -3'
Posted On2014-09-17