Incidental Mutation 'R2060:Utp20'
ID228637
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 040065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R2060 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88774795 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1442 (D1442E)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: D1442E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: D1442E

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220275
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abca14 G A 7: 120,227,518 W462* probably null Het
Aftph A T 11: 20,692,571 Y821N probably damaging Het
Ahnak A T 19: 9,008,041 M2230L probably benign Het
Arfgap1 T C 2: 180,972,782 F144L probably benign Het
Arid4b C T 13: 14,195,452 R1178C probably damaging Het
Asb8 A T 15: 98,141,373 C49S possibly damaging Het
Baz1b A G 5: 135,205,114 N165S probably damaging Het
BC017158 A G 7: 128,288,331 L176P probably damaging Het
Bod1l A T 5: 41,808,742 I2660N possibly damaging Het
C2cd3 T C 7: 100,454,948 I825T probably damaging Het
C4b A G 17: 34,736,101 W804R probably damaging Het
Cadm3 A T 1: 173,344,402 D201E probably damaging Het
Cdh17 T C 4: 11,803,982 F552L probably benign Het
Cdh7 G C 1: 110,048,877 A91P probably damaging Het
Cela1 A G 15: 100,675,322 probably null Het
Clk3 T C 9: 57,751,117 Y582C probably damaging Het
Cma1 C T 14: 55,943,698 probably null Het
Ctcfl A G 2: 173,118,506 S95P probably benign Het
Cylc1 C A X: 111,123,123 T391K unknown Het
Cyp3a11 T A 5: 145,855,081 I501L probably benign Het
Cyp3a59 T A 5: 146,104,714 L356Q probably damaging Het
Dcdc2a A C 13: 25,107,710 D226A possibly damaging Het
Dlec1 A C 9: 119,112,086 T235P probably damaging Het
Dnaaf1 G A 8: 119,590,602 R290Q probably benign Het
Dnaaf5 C T 5: 139,178,003 R377W probably damaging Het
Dpep1 T A 8: 123,200,391 V293E probably damaging Het
Drosha T A 15: 12,924,159 V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 I596L possibly damaging Het
Edem1 T A 6: 108,854,287 Y570N probably damaging Het
Edrf1 G T 7: 133,657,129 E9* probably null Het
Enpep T A 3: 129,280,523 N792Y probably benign Het
Enpp2 A T 15: 54,875,714 M391K probably damaging Het
Fanca A C 8: 123,274,481 V1105G probably damaging Het
Fbxo22 T A 9: 55,218,383 L74I probably damaging Het
Fchsd2 T A 7: 101,277,417 F571L probably benign Het
Fhad1 T C 4: 141,899,249 D1345G probably benign Het
G2e3 T C 12: 51,372,606 F702L probably damaging Het
Glce A T 9: 62,060,946 S308T possibly damaging Het
Glt1d1 A G 5: 127,657,119 D119G probably benign Het
Gpr137c T C 14: 45,244,159 I144T probably damaging Het
Gprin3 A G 6: 59,354,519 C268R possibly damaging Het
Hadha G A 5: 30,128,836 T395M probably benign Het
Hdhd2 T G 18: 76,965,042 probably null Het
Homer2 C T 7: 81,618,703 E70K probably benign Het
Hp1bp3 T A 4: 138,240,672 D397E probably damaging Het
Hrh3 T C 2: 180,101,250 N195S possibly damaging Het
Hyou1 T C 9: 44,381,552 V153A probably benign Het
Igf2r A T 17: 12,701,319 S1378T possibly damaging Het
Ints4 G A 7: 97,501,763 R279H possibly damaging Het
Itga10 A T 3: 96,654,998 R699* probably null Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Itsn2 T G 12: 4,627,879 F79V probably damaging Het
Jak3 C A 8: 71,680,714 C350* probably null Het
Jak3 A T 8: 71,683,415 K620* probably null Het
Kcnq5 T C 1: 21,461,597 S421G probably benign Het
Kdm2b A T 5: 122,883,365 M50K probably damaging Het
Klk1b1 A G 7: 43,970,623 D170G possibly damaging Het
Lama3 A T 18: 12,528,726 T2160S probably benign Het
Lman1 A T 18: 65,998,352 probably benign Het
Lmtk3 G A 7: 45,800,911 probably null Het
Ltb A G 17: 35,195,763 R180G probably damaging Het
Ltbp4 C T 7: 27,308,953 R1310Q probably damaging Het
Macf1 T A 4: 123,499,919 probably null Het
Mast4 G T 13: 102,738,846 P1146Q probably damaging Het
Micall2 C T 5: 139,711,562 S678N probably damaging Het
Mon2 A T 10: 122,995,776 I1675N probably damaging Het
Mug2 A G 6: 122,079,612 N1172S probably benign Het
Naa30 C G 14: 49,173,099 S161R possibly damaging Het
Ncaph T C 2: 127,124,875 N220D probably damaging Het
Nell1 T C 7: 50,560,830 V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 N142S possibly damaging Het
Nin T A 12: 70,042,418 T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 noncoding transcript Het
Nrg1 T G 8: 31,918,015 E63D probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1167 T C 2: 88,149,143 Y292C probably damaging Het
Olfr128 A G 17: 37,923,880 T105A probably benign Het
Olfr473 C T 7: 107,933,661 T47M probably benign Het
Olfr522 T A 7: 140,162,824 E42V probably damaging Het
Olfr845 A G 9: 19,339,056 I199V probably benign Het
Olfr851 T A 9: 19,497,237 V163E possibly damaging Het
Olfr867 A T 9: 20,054,596 I289N probably damaging Het
Olfr998 G A 2: 85,591,283 V248I possibly damaging Het
Orc5 C T 5: 22,516,703 probably null Het
Pard3 G A 8: 127,398,604 R691Q probably benign Het
Pofut1 T A 2: 153,243,660 D54E probably benign Het
Prl2c5 T A 13: 13,190,653 V128E probably damaging Het
Ptk7 T C 17: 46,566,238 M965V possibly damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Pzp A T 6: 128,483,710 N1494K probably benign Het
Rad21l A G 2: 151,645,429 V545A probably benign Het
Rps6kc1 A T 1: 190,810,108 M352K possibly damaging Het
Rpusd2 G A 2: 119,037,215 probably null Het
Rsph14 A T 10: 75,029,771 D78E probably damaging Het
Rtl9 A T X: 143,102,030 M813L possibly damaging Het
Rtp4 A T 16: 23,612,940 H74L probably damaging Het
Rusc1 G A 3: 89,087,848 T725I possibly damaging Het
Ryr2 C T 13: 11,595,736 C4068Y probably damaging Het
Ryr3 A G 2: 112,954,364 V224A possibly damaging Het
Shprh A T 10: 11,152,120 N157I probably benign Het
Siglece A G 7: 43,657,786 I67T probably benign Het
Slc9b2 A T 3: 135,326,266 T296S probably damaging Het
Sorbs2 A G 8: 45,775,629 K276E probably damaging Het
Synj2 A G 17: 6,037,480 T1269A probably benign Het
Taar7b T C 10: 24,000,675 I246T possibly damaging Het
Taldo1 A G 7: 141,396,154 Y113C probably damaging Het
Tarbp1 A T 8: 126,447,594 probably null Het
Tars C T 15: 11,394,373 M59I probably benign Het
Tas2r130 G A 6: 131,630,817 T5I probably benign Het
Tex48 T C 4: 63,607,415 E77G probably damaging Het
Tmco5 A G 2: 116,892,255 R286G probably damaging Het
Trdmt1 A T 2: 13,519,914 H243Q probably benign Het
Ttn T A 2: 76,734,294 R26754* probably null Het
Ttn G A 2: 76,897,580 probably benign Het
Ubqln3 A C 7: 104,142,151 L244R probably damaging Het
Ubxn1 C T 19: 8,873,566 R115* probably null Het
Umod T G 7: 119,476,715 N276T probably damaging Het
Unc13c A T 9: 73,665,656 L1528Q probably damaging Het
Unc80 T A 1: 66,640,595 H2108Q possibly damaging Het
Utp4 A G 8: 106,898,521 Q144R probably benign Het
Vmn2r17 T A 5: 109,427,209 N127K probably benign Het
Vmn2r75 T A 7: 86,165,164 T374S probably benign Het
Washc5 A G 15: 59,350,408 F523L probably damaging Het
Wdr3 A T 3: 100,159,897 probably null Het
Wdr89 T C 12: 75,632,988 Y164C probably damaging Het
Xpo5 T C 17: 46,225,091 S550P probably damaging Het
Zfp69 T C 4: 120,930,832 T429A probably damaging Het
Zfpm1 G T 8: 122,336,592 G797C probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAACAGCCCAAGGGTCTG -3'
(R):5'- AGCCAGAAATGCTGCCTATTAAC -3'

Sequencing Primer
(F):5'- CCAAGGGTCTGCCATGAC -3'
(R):5'- AAACATATTGCCCTTTCCTTTCAGAG -3'
Posted On2014-09-17