Incidental Mutation 'R2062:Nebl'
ID228735
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17397121 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 427 (M427K)
Ref Sequence ENSEMBL: ENSMUSP00000121313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124270
AA Change: M462K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: M462K

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131957
AA Change: M427K

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: M427K

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132418
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145492
AA Change: M427K

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: M427K

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 unclassified probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCACACGTCAATGCCGC -3'
(R):5'- ACATTCTGTTGGACATTGGTCTC -3'

Sequencing Primer
(F):5'- CCCATGGAGCTTTGAGAGATC -3'
(R):5'- TGACAAGTGCTTTACCCACTGAG -3'
Posted On2014-09-17