Incidental Mutation 'R2062:Sema5a'
ID228799
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 32609217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably benign
Transcript: ENSMUST00000067458
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228442
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0413:Sema5a UTSW 15 32669444 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1550:Sema5a UTSW 15 32618849 missense probably benign 0.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6220:Sema5a UTSW 15 32686729 missense probably damaging 0.99
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCTCAGGCTTGCAACTGC -3'
(R):5'- ACATGCTCCTGTAGTCCCAC -3'

Sequencing Primer
(F):5'- AGATCAGGAGTTCTCACCACTGG -3'
(R):5'- CACAAATAGGACACTCTGGCTGTG -3'
Posted On2014-09-17