Incidental Mutation 'R2062:Il2rg'
ID228814
Institutional Source Beutler Lab
Gene Symbol Il2rg
Ensembl Gene ENSMUSG00000031304
Gene Nameinterleukin 2 receptor, gamma chain
Synonymscommon cytokine receptor gamma chain, gc, gamma C receptor, common gamma chain, gamma(c), CD132, [g]c
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2062 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101264378-101268255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101267810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 57 (L57P)
Ref Sequence ENSEMBL: ENSMUSP00000033664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033664] [ENSMUST00000101358] [ENSMUST00000117736] [ENSMUST00000135038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033664
AA Change: L57P

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033664
Gene: ENSMUSG00000031304
AA Change: L57P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:IL6Ra-bind 56 151 1.1e-12 PFAM
FN3 154 235 2.44e-5 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101358
SMART Domains Protein: ENSMUSP00000098910
Gene: ENSMUSG00000090141

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117736
SMART Domains Protein: ENSMUSP00000112905
Gene: ENSMUSG00000092463

DomainStartEndE-ValueType
FN3 88 169 2.44e-5 SMART
transmembrane domain 192 214 N/A INTRINSIC
Pfam:Il2rg 262 359 1.1e-32 PFAM
low complexity region 404 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127538
Predicted Effect probably benign
Transcript: ENSMUST00000135038
SMART Domains Protein: ENSMUSP00000123318
Gene: ENSMUSG00000031304

DomainStartEndE-ValueType
FN3 44 125 2.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145074
Meta Mutation Damage Score 0.3508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is a common subunit of several interleukin receptor complexes. These receptors are comprised of alpha and beta subunits in addition to this gamma subunit. Signalling through this pathway in important in immune cell differentiation and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Males hemizygous for targeted null mutations exhibit markedly reduced numbers of T and B cells, lack NK cells and Peyer's patches, and have severely reduced numbers of gut-associated intraepithelial lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Il2rg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Il2rg APN X 101264848 unclassified probably benign
R2063:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2064:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2065:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2066:Il2rg UTSW X 101267810 missense possibly damaging 0.74
R2068:Il2rg UTSW X 101267810 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGATTGGGTCCTCAAGCAG -3'
(R):5'- CTAGGACCAGAGGGAGTTGTTG -3'

Sequencing Primer
(F):5'- GATTGGGTCCTCAAGCAGTCTCTC -3'
(R):5'- GGCCTGCTAGTGCTCACTATAATG -3'
Posted On2014-09-17