Incidental Mutation 'R2064:Ep400'
ID228957
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 040069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2064 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 110735404 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: N721K
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: N721K

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112433
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: N758K
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: N758K

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: N685K
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: N685K

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146458
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,186,165 S402T probably damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Actr1b A G 1: 36,702,087 F138L possibly damaging Het
Adamts14 G T 10: 61,205,522 P803Q probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Aldh16a1 C T 7: 45,147,161 probably null Het
Alg12 A G 15: 88,812,115 W238R probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Arhgap23 T A 11: 97,493,062 C1144S probably benign Het
Arhgef40 G A 14: 51,996,183 V829M probably damaging Het
Atg7 C A 6: 114,703,363 N344K probably damaging Het
Aunip T A 4: 134,523,307 S188T probably benign Het
Bmpr1b A T 3: 141,870,807 H88Q probably benign Het
Brpf3 G A 17: 28,821,364 G920S probably benign Het
Cdc123 C T 2: 5,795,543 probably benign Het
Cdhr1 T C 14: 37,095,105 R100G probably benign Het
Cdkn2d A G 9: 21,290,879 V24A probably damaging Het
Cirbp T C 10: 80,170,332 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Col12a1 A G 9: 79,662,454 probably benign Het
Cpox T A 16: 58,674,409 C270S probably benign Het
Cspg4 A G 9: 56,896,656 D1677G probably damaging Het
Cyp4a10 T A 4: 115,524,720 probably benign Het
Dctn4 T C 18: 60,538,277 F74L possibly damaging Het
Dennd5a G A 7: 109,898,693 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah9 C T 11: 66,145,435 S185N probably benign Het
Dqx1 T G 6: 83,058,543 probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Exoc2 T C 13: 30,935,561 D119G probably benign Het
Fbn2 C T 18: 58,048,849 E1827K probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgd6 G A 10: 94,045,041 A586T probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm12888 A T 4: 121,324,872 W8R unknown Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6214 A G 3: 140,839,217 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gmeb2 A G 2: 181,253,970 L469P probably benign Het
Gosr1 T C 11: 76,737,398 I177V probably benign Het
Gria1 T C 11: 57,317,708 F810L probably damaging Het
Gtf2ird2 C T 5: 134,216,498 Q533* probably null Het
Hadhb T A 5: 30,173,798 probably null Het
Hat1 A T 2: 71,410,160 Y66F possibly damaging Het
Hk1 T C 10: 62,286,536 Y488C probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il19 T C 1: 130,939,117 H42R probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Impg2 G A 16: 56,243,630 probably null Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itga9 T C 9: 118,807,293 F683S probably damaging Het
Itih2 A G 2: 10,130,574 S2P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Kcnab1 A G 3: 65,364,639 E315G probably benign Het
Kcnmb2 A C 3: 32,198,288 I213L probably damaging Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl28 T C 12: 64,943,472 N565S probably benign Het
Lcp1 A G 14: 75,198,075 probably null Het
Mcm4 T C 16: 15,634,469 T267A possibly damaging Het
Mlxipl A T 5: 135,132,777 T517S possibly damaging Het
Mpp3 T A 11: 102,000,690 I541L probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myh15 G A 16: 49,155,621 A1351T possibly damaging Het
Nacc1 A T 8: 84,673,118 M490K probably benign Het
Nbeal1 C A 1: 60,270,356 Q496K possibly damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr125 T A 17: 37,835,002 M1K probably null Het
Pard3 T C 8: 127,610,611 L1236P probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phf21a C A 2: 92,327,077 N183K possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl3c1 G A 13: 27,196,737 probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Psg16 T G 7: 17,093,748 S210A possibly damaging Het
Psg25 T A 7: 18,521,253 K446M probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rgs7 A T 1: 175,121,942 F160L probably damaging Het
Rpl22l1 A T 3: 28,806,808 E57D possibly damaging Het
Rpl35 A G 2: 39,004,741 L44P possibly damaging Het
Rtn4r T C 16: 18,151,257 L183P probably damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc4a7 G A 14: 14,733,773 R67H probably damaging Het
Smg1 C T 7: 118,156,867 probably benign Het
Smurf2 T C 11: 106,871,548 T39A probably damaging Het
Sspo A T 6: 48,473,662 D2595V probably damaging Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tbc1d14 G A 5: 36,522,930 R68* probably null Het
Tgm1 A G 14: 55,709,471 I360T probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Traf1 A T 2: 34,948,190 I212N probably benign Het
Ttc17 C A 2: 94,366,547 W485L probably damaging Het
Ttn C A 2: 76,938,331 V2920F probably damaging Het
Tyr T C 7: 87,492,843 I93V probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn1r212 A G 13: 22,884,115 V16A probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Xirp1 T C 9: 120,016,896 I974V probably benign Het
Zap70 A G 1: 36,779,134 T301A probably benign Het
Zfhx4 A G 3: 5,398,927 K1382E probably damaging Het
Zfp280b T A 10: 76,039,183 C299S probably damaging Het
Zfp352 C T 4: 90,225,120 S499L probably benign Het
Zfp423 G A 8: 87,781,358 A661V probably benign Het
Zfp57 T A 17: 37,009,676 F141I possibly damaging Het
Zfp946 A T 17: 22,455,465 H400L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense not run
R7272:Ep400 UTSW 5 110755645 nonsense probably null
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- TACTCTCTTGGCCAGGTTGG -3'
(R):5'- TAGACAGTGGCATCGACCAG -3'

Sequencing Primer
(F):5'- CCAGGTTGGGAGCAAGATCC -3'
(R):5'- TTGGACTCTGCCCAGCC -3'
Posted On2014-09-17