Incidental Mutation 'R2064:2410089E03Rik'
ID229014
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 040069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2064 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8186165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 402 (S402T)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably damaging
Transcript: ENSMUST00000110617
AA Change: S402T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: S402T

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150869
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Actr1b A G 1: 36,702,087 F138L possibly damaging Het
Adamts14 G T 10: 61,205,522 P803Q probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Aldh16a1 C T 7: 45,147,161 probably null Het
Alg12 A G 15: 88,812,115 W238R probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Arhgap23 T A 11: 97,493,062 C1144S probably benign Het
Arhgef40 G A 14: 51,996,183 V829M probably damaging Het
Atg7 C A 6: 114,703,363 N344K probably damaging Het
Aunip T A 4: 134,523,307 S188T probably benign Het
Bmpr1b A T 3: 141,870,807 H88Q probably benign Het
Brpf3 G A 17: 28,821,364 G920S probably benign Het
Cdc123 C T 2: 5,795,543 probably benign Het
Cdhr1 T C 14: 37,095,105 R100G probably benign Het
Cdkn2d A G 9: 21,290,879 V24A probably damaging Het
Cirbp T C 10: 80,170,332 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Col12a1 A G 9: 79,662,454 probably benign Het
Cpox T A 16: 58,674,409 C270S probably benign Het
Cspg4 A G 9: 56,896,656 D1677G probably damaging Het
Cyp4a10 T A 4: 115,524,720 probably benign Het
Dctn4 T C 18: 60,538,277 F74L possibly damaging Het
Dennd5a G A 7: 109,898,693 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah9 C T 11: 66,145,435 S185N probably benign Het
Dqx1 T G 6: 83,058,543 probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ep400 A C 5: 110,735,404 probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Exoc2 T C 13: 30,935,561 D119G probably benign Het
Fbn2 C T 18: 58,048,849 E1827K probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgd6 G A 10: 94,045,041 A586T probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm12888 A T 4: 121,324,872 W8R unknown Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6214 A G 3: 140,839,217 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gmeb2 A G 2: 181,253,970 L469P probably benign Het
Gosr1 T C 11: 76,737,398 I177V probably benign Het
Gria1 T C 11: 57,317,708 F810L probably damaging Het
Gtf2ird2 C T 5: 134,216,498 Q533* probably null Het
Hadhb T A 5: 30,173,798 probably null Het
Hat1 A T 2: 71,410,160 Y66F possibly damaging Het
Hk1 T C 10: 62,286,536 Y488C probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il19 T C 1: 130,939,117 H42R probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Impg2 G A 16: 56,243,630 probably null Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itga9 T C 9: 118,807,293 F683S probably damaging Het
Itih2 A G 2: 10,130,574 S2P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Kcnab1 A G 3: 65,364,639 E315G probably benign Het
Kcnmb2 A C 3: 32,198,288 I213L probably damaging Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl28 T C 12: 64,943,472 N565S probably benign Het
Lcp1 A G 14: 75,198,075 probably null Het
Mcm4 T C 16: 15,634,469 T267A possibly damaging Het
Mlxipl A T 5: 135,132,777 T517S possibly damaging Het
Mpp3 T A 11: 102,000,690 I541L probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myh15 G A 16: 49,155,621 A1351T possibly damaging Het
Nacc1 A T 8: 84,673,118 M490K probably benign Het
Nbeal1 C A 1: 60,270,356 Q496K possibly damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr125 T A 17: 37,835,002 M1K probably null Het
Pard3 T C 8: 127,610,611 L1236P probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phf21a C A 2: 92,327,077 N183K possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl3c1 G A 13: 27,196,737 probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Psg16 T G 7: 17,093,748 S210A possibly damaging Het
Psg25 T A 7: 18,521,253 K446M probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rgs7 A T 1: 175,121,942 F160L probably damaging Het
Rpl22l1 A T 3: 28,806,808 E57D possibly damaging Het
Rpl35 A G 2: 39,004,741 L44P possibly damaging Het
Rtn4r T C 16: 18,151,257 L183P probably damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc4a7 G A 14: 14,733,773 R67H probably damaging Het
Smg1 C T 7: 118,156,867 probably benign Het
Smurf2 T C 11: 106,871,548 T39A probably damaging Het
Sspo A T 6: 48,473,662 D2595V probably damaging Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tbc1d14 G A 5: 36,522,930 R68* probably null Het
Tgm1 A G 14: 55,709,471 I360T probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Traf1 A T 2: 34,948,190 I212N probably benign Het
Ttc17 C A 2: 94,366,547 W485L probably damaging Het
Ttn C A 2: 76,938,331 V2920F probably damaging Het
Tyr T C 7: 87,492,843 I93V probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn1r212 A G 13: 22,884,115 V16A probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Xirp1 T C 9: 120,016,896 I974V probably benign Het
Zap70 A G 1: 36,779,134 T301A probably benign Het
Zfhx4 A G 3: 5,398,927 K1382E probably damaging Het
Zfp280b T A 10: 76,039,183 C299S probably damaging Het
Zfp352 C T 4: 90,225,120 S499L probably benign Het
Zfp423 G A 8: 87,781,358 A661V probably benign Het
Zfp57 T A 17: 37,009,676 F141I possibly damaging Het
Zfp946 A T 17: 22,455,465 H400L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- GATCATTGTATGTTTCCTGGAAGAC -3'
(R):5'- GCACTGTACCTCAGACAGCATC -3'

Sequencing Primer
(F):5'- AATACTTTGATGTGTGTCTCATCTGC -3'
(R):5'- TGTACCTCAGACAGCATCATACTCTG -3'
Posted On2014-09-17