Incidental Mutation 'R2064:Cpox'
ID229020
Institutional Source Beutler Lab
Gene Symbol Cpox
Ensembl Gene ENSMUSG00000022742
Gene Namecoproporphyrinogen oxidase
Synonymsnct, Cpo, cac, clone 560
MMRRC Submission 040069-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R2064 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58670292-58717636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58674409 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 270 (C270S)
Ref Sequence ENSEMBL: ENSMUSP00000055455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060077]
Predicted Effect probably benign
Transcript: ENSMUST00000060077
AA Change: C270S

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: C270S

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:Coprogen_oxidas 140 442 7.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,186,165 S402T probably damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Actr1b A G 1: 36,702,087 F138L possibly damaging Het
Adamts14 G T 10: 61,205,522 P803Q probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Aldh16a1 C T 7: 45,147,161 probably null Het
Alg12 A G 15: 88,812,115 W238R probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Arhgap23 T A 11: 97,493,062 C1144S probably benign Het
Arhgef40 G A 14: 51,996,183 V829M probably damaging Het
Atg7 C A 6: 114,703,363 N344K probably damaging Het
Aunip T A 4: 134,523,307 S188T probably benign Het
Bmpr1b A T 3: 141,870,807 H88Q probably benign Het
Brpf3 G A 17: 28,821,364 G920S probably benign Het
Cdc123 C T 2: 5,795,543 probably benign Het
Cdhr1 T C 14: 37,095,105 R100G probably benign Het
Cdkn2d A G 9: 21,290,879 V24A probably damaging Het
Cirbp T C 10: 80,170,332 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Col12a1 A G 9: 79,662,454 probably benign Het
Cspg4 A G 9: 56,896,656 D1677G probably damaging Het
Cyp4a10 T A 4: 115,524,720 probably benign Het
Dctn4 T C 18: 60,538,277 F74L possibly damaging Het
Dennd5a G A 7: 109,898,693 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah9 C T 11: 66,145,435 S185N probably benign Het
Dqx1 T G 6: 83,058,543 probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ep400 A C 5: 110,735,404 probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Exoc2 T C 13: 30,935,561 D119G probably benign Het
Fbn2 C T 18: 58,048,849 E1827K probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgd6 G A 10: 94,045,041 A586T probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm12888 A T 4: 121,324,872 W8R unknown Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6214 A G 3: 140,839,217 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gmeb2 A G 2: 181,253,970 L469P probably benign Het
Gosr1 T C 11: 76,737,398 I177V probably benign Het
Gria1 T C 11: 57,317,708 F810L probably damaging Het
Gtf2ird2 C T 5: 134,216,498 Q533* probably null Het
Hadhb T A 5: 30,173,798 probably null Het
Hat1 A T 2: 71,410,160 Y66F possibly damaging Het
Hk1 T C 10: 62,286,536 Y488C probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il19 T C 1: 130,939,117 H42R probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Impg2 G A 16: 56,243,630 probably null Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itga9 T C 9: 118,807,293 F683S probably damaging Het
Itih2 A G 2: 10,130,574 S2P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Kcnab1 A G 3: 65,364,639 E315G probably benign Het
Kcnmb2 A C 3: 32,198,288 I213L probably damaging Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl28 T C 12: 64,943,472 N565S probably benign Het
Lcp1 A G 14: 75,198,075 probably null Het
Mcm4 T C 16: 15,634,469 T267A possibly damaging Het
Mlxipl A T 5: 135,132,777 T517S possibly damaging Het
Mpp3 T A 11: 102,000,690 I541L probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myh15 G A 16: 49,155,621 A1351T possibly damaging Het
Nacc1 A T 8: 84,673,118 M490K probably benign Het
Nbeal1 C A 1: 60,270,356 Q496K possibly damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr125 T A 17: 37,835,002 M1K probably null Het
Pard3 T C 8: 127,610,611 L1236P probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phf21a C A 2: 92,327,077 N183K possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl3c1 G A 13: 27,196,737 probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Psg16 T G 7: 17,093,748 S210A possibly damaging Het
Psg25 T A 7: 18,521,253 K446M probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rgs7 A T 1: 175,121,942 F160L probably damaging Het
Rpl22l1 A T 3: 28,806,808 E57D possibly damaging Het
Rpl35 A G 2: 39,004,741 L44P possibly damaging Het
Rtn4r T C 16: 18,151,257 L183P probably damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc4a7 G A 14: 14,733,773 R67H probably damaging Het
Smg1 C T 7: 118,156,867 probably benign Het
Smurf2 T C 11: 106,871,548 T39A probably damaging Het
Sspo A T 6: 48,473,662 D2595V probably damaging Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tbc1d14 G A 5: 36,522,930 R68* probably null Het
Tgm1 A G 14: 55,709,471 I360T probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Traf1 A T 2: 34,948,190 I212N probably benign Het
Ttc17 C A 2: 94,366,547 W485L probably damaging Het
Ttn C A 2: 76,938,331 V2920F probably damaging Het
Tyr T C 7: 87,492,843 I93V probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn1r212 A G 13: 22,884,115 V16A probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Xirp1 T C 9: 120,016,896 I974V probably benign Het
Zap70 A G 1: 36,779,134 T301A probably benign Het
Zfhx4 A G 3: 5,398,927 K1382E probably damaging Het
Zfp280b T A 10: 76,039,183 C299S probably damaging Het
Zfp352 C T 4: 90,225,120 S499L probably benign Het
Zfp423 G A 8: 87,781,358 A661V probably benign Het
Zfp57 T A 17: 37,009,676 F141I possibly damaging Het
Zfp946 A T 17: 22,455,465 H400L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Cpox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cpox APN 16 58674424 missense possibly damaging 0.87
IGL03031:Cpox APN 16 58672560 missense probably damaging 1.00
IGL03034:Cpox APN 16 58675355 missense probably damaging 0.98
scraggy UTSW 16 58670935 missense probably damaging 1.00
R0413:Cpox UTSW 16 58670869 missense possibly damaging 0.52
R0523:Cpox UTSW 16 58675245 nonsense probably null
R0551:Cpox UTSW 16 58675390 missense probably benign 0.11
R4651:Cpox UTSW 16 58670687 missense possibly damaging 0.92
R4701:Cpox UTSW 16 58677969 nonsense probably null
R4782:Cpox UTSW 16 58672623 missense probably damaging 1.00
R5285:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5287:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5313:Cpox UTSW 16 58677948 nonsense probably null
R5346:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5354:Cpox UTSW 16 58670842 missense probably damaging 0.99
R5404:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5476:Cpox UTSW 16 58678725 missense probably damaging 0.99
R5853:Cpox UTSW 16 58675417 missense probably damaging 0.99
R6026:Cpox UTSW 16 58670935 missense probably damaging 1.00
R7059:Cpox UTSW 16 58670927 missense probably damaging 1.00
R7061:Cpox UTSW 16 58670860 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACCGTTAATACTCGAGGCCC -3'
(R):5'- TCTTTATATAAATCAGGCCTACGGG -3'

Sequencing Primer
(F):5'- AATACTCGAGGCCCTCCGTC -3'
(R):5'- CTACGGGCAAGTCTTTTCAAAC -3'
Posted On2014-09-17