Incidental Mutation 'R2065:Ubr5'
ID229112
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 040070-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2065 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38040842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 266 (D266G)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably damaging
Transcript: ENSMUST00000110336
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: D266G

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Adh6a T A 3: 138,325,237 D162E probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI182371 A G 2: 35,086,429 probably null Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Ap3b2 A G 7: 81,463,774 S896P unknown Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atp11b T A 3: 35,839,074 Y859N probably damaging Het
Bag3 T A 7: 128,545,774 V371D probably damaging Het
Bhmt T C 13: 93,617,612 Y363C probably benign Het
Btbd6 T C 12: 112,978,135 Y356H probably damaging Het
C2cd2l C T 9: 44,316,335 R172Q probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cyp26b1 T C 6: 84,576,555 M206V probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ece1 A T 4: 137,958,082 M628L probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Erich6b T C 14: 75,658,911 I79T probably benign Het
F7 T A 8: 13,035,183 V403D probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fbxw28 T C 9: 109,328,224 K319E probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Flg2 A G 3: 93,202,231 E522G unknown Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm7361 A T 5: 26,262,151 D256V probably damaging Het
Hpse A G 5: 100,698,931 S211P probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Iqca T C 1: 90,130,231 S249G probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl42 T A 6: 147,101,663 W312R probably damaging Het
L3mbtl4 C A 17: 68,425,692 Q56K probably benign Het
Lce1k G A 3: 92,806,857 Q7* probably null Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Mbd1 C A 18: 74,276,884 T373K probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nbas T A 12: 13,566,157 L2232Q probably damaging Het
Ncr1 T C 7: 4,338,207 F29L probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Olfr1295 A G 2: 111,564,712 I244T probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr498 T A 7: 108,465,668 C115S possibly damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Orc2 A G 1: 58,469,695 V431A probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pigr G A 1: 130,850,880 G767D probably benign Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prokr1 T C 6: 87,588,713 E50G probably damaging Het
Prph A T 15: 99,056,133 D196V probably damaging Het
Rapgef5 C A 12: 117,584,119 C234* probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc22a16 A G 10: 40,585,020 I273V possibly damaging Het
Snx13 T C 12: 35,138,066 M781T possibly damaging Het
Spag17 A G 3: 100,013,208 I420V probably benign Het
Synj1 T C 16: 90,991,649 probably null Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tcaf2 T A 6: 42,628,047 N601I probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem132d T C 5: 127,784,441 D872G probably benign Het
Troap T C 15: 99,082,463 L508P probably benign Het
Trpd52l3 T C 19: 30,003,962 V39A probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGCTCAGATACAGGTGGG -3'
(R):5'- CAGACTGTTCGTCCTTAAGGTC -3'

Sequencing Primer
(F):5'- CAGATACAGGTGGGTTTATCACTAGC -3'
(R):5'- TAGATCTTGGGGGACACTCCTC -3'
Posted On2014-09-17