Incidental Mutation 'R2076:Csn2'
ID229144
Institutional Source Beutler Lab
Gene Symbol Csn2
Ensembl Gene ENSMUSG00000063157
Gene Namecasein beta
SynonymsCsnb, CSN2
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.012) question?
Stock #R2076 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87692624-87699630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87696174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000142971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082370] [ENSMUST00000196163] [ENSMUST00000196869] [ENSMUST00000197422] [ENSMUST00000198057] [ENSMUST00000199624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082370
AA Change: S34P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080976
Gene: ENSMUSG00000063157
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 221 1.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196163
AA Change: S26P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142673
Gene: ENSMUSG00000063157
AA Change: S26P

DomainStartEndE-ValueType
Pfam:Casein 134 215 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196664
Predicted Effect probably damaging
Transcript: ENSMUST00000196869
AA Change: S19P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142971
Gene: ENSMUSG00000063157
AA Change: S19P

DomainStartEndE-ValueType
Pfam:Casein 126 207 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197281
Predicted Effect possibly damaging
Transcript: ENSMUST00000197422
AA Change: S34P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143341
Gene: ENSMUSG00000063157
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197687
Predicted Effect possibly damaging
Transcript: ENSMUST00000198057
AA Change: S34P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143709
Gene: ENSMUSG00000063157
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 141 220 4.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199624
AA Change: S34P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143409
Gene: ENSMUSG00000063157
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200627
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta casein family. There are two types of casein protein, beta (encoded by this gene) and kappa, both of which are secreted in human milk. Beta casein is the principal protein in human milk and the primary source of essential amino acids for a suckling infant. Beta and kappa casein proteins acting together form spherical micelles which bind within them important dietary minerals, such as calcium and phosphorous. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Female mice homozygous for disruption of this gene produce mile with a low protein content and poor nutritional value. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Csn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Csn2 APN 5 87694773 missense probably benign 0.01
IGL01458:Csn2 APN 5 87696020 splice site probably benign
IGL01526:Csn2 APN 5 87694979 missense possibly damaging 0.92
IGL01588:Csn2 APN 5 87694649 missense probably benign 0.08
IGL02034:Csn2 APN 5 87696082 splice site probably benign
IGL02277:Csn2 APN 5 87698022 splice site probably benign
IGL03267:Csn2 APN 5 87698071 missense possibly damaging 0.85
R0730:Csn2 UTSW 5 87694952 missense possibly damaging 0.85
R1055:Csn2 UTSW 5 87694737 missense possibly damaging 0.93
R1488:Csn2 UTSW 5 87694896 nonsense probably null
R4039:Csn2 UTSW 5 87698076 start codon destroyed probably null 0.33
R4322:Csn2 UTSW 5 87698027 critical splice donor site probably null
R5207:Csn2 UTSW 5 87694962 nonsense probably null
R5362:Csn2 UTSW 5 87694649 missense probably benign 0.01
R6191:Csn2 UTSW 5 87696026 critical splice donor site probably null
R6600:Csn2 UTSW 5 87694632 missense probably benign 0.25
Z1088:Csn2 UTSW 5 87696009 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTATTGGTGCCCACATGAGC -3'
(R):5'- CTGCACTCACTTTTCTTGTAAACAG -3'

Sequencing Primer
(F):5'- GGTGCCCACATGAGCTTTCTAG -3'
(R):5'- CTCACTTTTCTTGTAAACAGTAGGC -3'
Posted On2014-09-17