Incidental Mutation 'R2076:Hivep1'
ID229175
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R2076 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 42164393 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148]
Predicted Effect probably null
Transcript: ENSMUST00000060148
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222854
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTGCAGAAACTAGGAATCTTCTC -3'
(R):5'- AACCCTGTCATTAGAAGTACTTTCC -3'

Sequencing Primer
(F):5'- GTGCATAAAACCATTGGAGATTTGTG -3'
(R):5'- AGAAGTACTTTCCTTAAAGGGTCTAG -3'
Posted On2014-09-17