Incidental Mutation 'R2077:Crygd'
ID229198
Institutional Source Beutler Lab
Gene Symbol Crygd
Ensembl Gene ENSMUSG00000067299
Gene Namecrystallin, gamma D
SynonymsCryg-1, DGcry-1, Aey4
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65061872-65063452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65063246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000122528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045028] [ENSMUST00000146122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045028
AA Change: D22G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045327
Gene: ENSMUSG00000067299
AA Change: D22G

DomainStartEndE-ValueType
XTALbg 3 82 3.23e-45 SMART
XTALbg 89 170 4.09e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127762
Predicted Effect probably damaging
Transcript: ENSMUST00000146122
AA Change: D19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122528
Gene: ENSMUSG00000067299
AA Change: D19G

DomainStartEndE-ValueType
XTALbg 1 79 1.77e-42 SMART
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes for a spontaneous mutation exhibit a dense nuclear cataract and mild microphthalmia by 2-months of age, followed by posterior capsular rupture into the posterior vitreous by 3-months. In homozygotes, the microphthalmia is more pronounced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Crygd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Crygd APN 1 65062091 missense probably benign 0.32
IGL00640:Crygd APN 1 65062091 missense probably benign 0.32
IGL00650:Crygd APN 1 65062091 missense probably benign 0.32
IGL00654:Crygd APN 1 65062091 missense probably benign 0.32
IGL00732:Crygd APN 1 65062091 missense probably benign 0.32
IGL00755:Crygd APN 1 65062091 missense probably benign 0.32
IGL00772:Crygd APN 1 65062091 missense probably benign 0.32
IGL00788:Crygd APN 1 65062091 missense probably benign 0.32
IGL00852:Crygd APN 1 65062091 missense probably benign 0.32
IGL00861:Crygd APN 1 65062091 missense probably benign 0.32
IGL00863:Crygd APN 1 65062091 missense probably benign 0.32
IGL00864:Crygd APN 1 65062091 missense probably benign 0.32
IGL00885:Crygd APN 1 65062091 missense probably benign 0.32
IGL00886:Crygd APN 1 65062091 missense probably benign 0.32
IGL01939:Crygd APN 1 65062026 missense probably benign
L23 UTSW 1 65063084 missense probably damaging 1.00
R1400:Crygd UTSW 1 65063208 missense probably damaging 1.00
R1528:Crygd UTSW 1 65063057 critical splice donor site probably null
R1862:Crygd UTSW 1 65061974 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGAATCTGGACTCACGTGG -3'
(R):5'- ATATAGACCCTGCTCCCAGC -3'

Sequencing Primer
(F):5'- CTGGACTCACGTGGGGGATG -3'
(R):5'- GCACCATCCCATCCGACCTG -3'
Posted On2014-09-17