Incidental Mutation 'R2077:Arhgap25'
ID229210
Institutional Source Beutler Lab
Gene Symbol Arhgap25
Ensembl Gene ENSMUSG00000030047
Gene NameRho GTPase activating protein 25
Synonyms
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87458545-87533259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87460008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 620 (D620V)
Ref Sequence ENSEMBL: ENSMUSP00000109267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071024] [ENSMUST00000101197] [ENSMUST00000113637]
Predicted Effect probably damaging
Transcript: ENSMUST00000071024
AA Change: D531V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068964
Gene: ENSMUSG00000030047
AA Change: D531V

DomainStartEndE-ValueType
PDB:1V89|A 1 63 7e-33 PDB
Blast:RhoGAP 16 66 9e-22 BLAST
RhoGAP 86 262 6.28e-64 SMART
coiled coil region 454 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101197
AA Change: D594V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098758
Gene: ENSMUSG00000030047
AA Change: D594V

DomainStartEndE-ValueType
PH 21 127 2.11e-21 SMART
RhoGAP 149 325 6.28e-64 SMART
coiled coil region 517 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113637
AA Change: D620V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109267
Gene: ENSMUSG00000030047
AA Change: D620V

DomainStartEndE-ValueType
PH 47 153 2.11e-21 SMART
RhoGAP 175 351 6.28e-64 SMART
coiled coil region 543 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203559
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAPs, such as ARHGAP25, encode negative regulators of Rho GTPases (see ARHA; MIM 165390), which are implicated in actin remodeling, cell polarity, and cell migration (Katoh and Katoh, 2004 [PubMed 15254788]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukocyte transendothelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Arhgap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Arhgap25 APN 6 87496076 missense possibly damaging 0.92
IGL02112:Arhgap25 APN 6 87467937 missense possibly damaging 0.80
IGL03051:Arhgap25 APN 6 87495914 missense probably null 1.00
R0462:Arhgap25 UTSW 6 87459960 missense possibly damaging 0.88
R1636:Arhgap25 UTSW 6 87495941 missense probably damaging 1.00
R1777:Arhgap25 UTSW 6 87463307 missense probably benign 0.41
R2845:Arhgap25 UTSW 6 87459967 missense possibly damaging 0.86
R4091:Arhgap25 UTSW 6 87463035 missense probably benign
R4435:Arhgap25 UTSW 6 87462938 missense possibly damaging 0.56
R4773:Arhgap25 UTSW 6 87496071 missense probably benign
R5121:Arhgap25 UTSW 6 87532864 missense probably benign 0.01
R5169:Arhgap25 UTSW 6 87463270 missense possibly damaging 0.93
R5334:Arhgap25 UTSW 6 87463261 missense possibly damaging 0.77
R5726:Arhgap25 UTSW 6 87463459 missense probably benign
R6696:Arhgap25 UTSW 6 87465651 missense probably damaging 1.00
R6696:Arhgap25 UTSW 6 87466563 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATCCTAGGAGGTAACCCTG -3'
(R):5'- GCTAGACTGGCATCTTGTGTC -3'

Sequencing Primer
(F):5'- TGCTTCCAGCTCACTAGGAG -3'
(R):5'- TGTGTCTCACAAAGGCAAATG -3'
Posted On2014-09-17