Incidental Mutation 'R2077:Slit3'
ID229224
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R2077 (G1)
Quality Score153
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35544748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 169 (I169F)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069837
AA Change: I169F

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: I169F

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124438
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCTCAGACAGTCAGAGAG -3'
(R):5'- AGCATTGCAGCAGAAGACCC -3'

Sequencing Primer
(F):5'- TCCCTCAGACAGTCAGAGAGAAGAG -3'
(R):5'- TTGCAGCAGAAGACCCAGAAAC -3'
Posted On2014-09-17