Incidental Mutation 'R2077:Cops3'
ID229226
Institutional Source Beutler Lab
Gene Symbol Cops3
Ensembl Gene ENSMUSG00000019373
Gene NameCOP9 signalosome subunit 3
SynonymsCsn3, Sgn3, COP9 complex S3
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59817795-59839838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59824310 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 301 (S301T)
Ref Sequence ENSEMBL: ENSMUSP00000019517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019517
AA Change: S301T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019517
Gene: ENSMUSG00000019373
AA Change: S301T

DomainStartEndE-ValueType
PINT 293 383 1.16e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136901
Predicted Effect probably benign
Transcript: ENSMUST00000156837
AA Change: S223T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117288
Gene: ENSMUSG00000019373
AA Change: S223T

DomainStartEndE-ValueType
SCOP:d1ihga1 55 132 6e-4 SMART
Blast:PINT 216 244 4e-10 BLAST
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene possesses kinase activity that phosphorylates regulators involved in signal transduction. It phosphorylates I kappa-Balpha, p105, and c-Jun. It acts as a docking site for complex-mediated phosphorylation. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with defects in developmental patterning and failure of the inner cell mass to proliferate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Cops3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01957:Cops3 APN 11 59821391 splice site probably benign
IGL02622:Cops3 APN 11 59833038 missense probably benign 0.26
IGL02657:Cops3 APN 11 59830217 missense probably damaging 0.99
IGL03271:Cops3 APN 11 59833063 missense probably damaging 0.99
IGL03400:Cops3 APN 11 59818088 missense probably benign 0.02
R0449:Cops3 UTSW 11 59818417 critical splice donor site probably null
R0699:Cops3 UTSW 11 59826322 missense probably damaging 1.00
R1485:Cops3 UTSW 11 59827889 missense possibly damaging 0.85
R1894:Cops3 UTSW 11 59820018 missense probably benign 0.00
R2265:Cops3 UTSW 11 59827890 missense probably benign 0.06
R3790:Cops3 UTSW 11 59827971 missense probably benign 0.00
R4540:Cops3 UTSW 11 59830154 missense probably damaging 1.00
R4548:Cops3 UTSW 11 59827845 critical splice donor site probably null
R4930:Cops3 UTSW 11 59835367 intron probably benign
R5028:Cops3 UTSW 11 59818030 unclassified probably benign
R5150:Cops3 UTSW 11 59820013 missense probably damaging 0.99
R5319:Cops3 UTSW 11 59827936 missense possibly damaging 0.78
R5436:Cops3 UTSW 11 59824345 missense probably damaging 1.00
R5789:Cops3 UTSW 11 59830280 intron probably benign
R6211:Cops3 UTSW 11 59817901 unclassified probably benign
R6364:Cops3 UTSW 11 59835404 intron probably benign
R6442:Cops3 UTSW 11 59827954 missense probably benign 0.06
R6479:Cops3 UTSW 11 59833072 missense probably benign 0.34
R6622:Cops3 UTSW 11 59833134 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAACAGCTTCTCTCAGTG -3'
(R):5'- AAAACCAGGATTTGTGTTGGG -3'

Sequencing Primer
(F):5'- GCAACAGCTTCTCTCAGTGTAGAAG -3'
(R):5'- GCGATGTATTTTCTGAAAGTACACTG -3'
Posted On2014-09-17