Incidental Mutation 'R2077:Shpk'
ID229228
Institutional Source Beutler Lab
Gene Symbol Shpk
Ensembl Gene ENSMUSG00000005951
Gene Namesedoheptulokinase
Synonyms4930431K22Rik, Carkl
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73199460-73224511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73203959 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 67 (L67P)
Ref Sequence ENSEMBL: ENSMUSP00000123639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000006105] [ENSMUST00000108476] [ENSMUST00000131927]
Predicted Effect probably benign
Transcript: ENSMUST00000006103
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000006105
AA Change: L67P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006105
Gene: ENSMUSG00000005951
AA Change: L67P

DomainStartEndE-ValueType
Pfam:FGGY_N 6 264 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108476
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131927
AA Change: L67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123639
Gene: ENSMUSG00000005951
AA Change: L67P

DomainStartEndE-ValueType
Pfam:FGGY_N 6 109 3.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150468
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. Sequence variation between this novel gene and known carbohydrate kinases suggests the possibility of a different substrate, cofactor or changes in kinetic properties distinguishing it from other carbohydrate kinases. The gene resides in a region commonly deleted in cystinosis patients, suggesting a role as a modifier for the cystinosis phenotype. The genomic region is also rich in Alu repetitive sequences, frequently involved in chromosomal rearrangements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Shpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Shpk APN 11 73203995 missense probably damaging 1.00
IGL03411:Shpk APN 11 73215035 missense probably benign 0.25
R0125:Shpk UTSW 11 73214222 splice site probably benign
R0826:Shpk UTSW 11 73204031 missense probably damaging 1.00
R1055:Shpk UTSW 11 73215119 missense probably benign
R1670:Shpk UTSW 11 73222931 missense probably benign 0.00
R2263:Shpk UTSW 11 73206493 critical splice donor site probably benign
R5281:Shpk UTSW 11 73215120 missense probably benign 0.06
R5443:Shpk UTSW 11 73222781 missense possibly damaging 0.94
R5461:Shpk UTSW 11 73199535 missense probably benign 0.08
R6063:Shpk UTSW 11 73213444 nonsense probably null
R6424:Shpk UTSW 11 73213492 missense possibly damaging 0.50
R7150:Shpk UTSW 11 73213489 missense probably damaging 0.99
R7176:Shpk UTSW 11 73222988 missense probably benign 0.05
R7255:Shpk UTSW 11 73199660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGTCCAATGCTGTGCTTC -3'
(R):5'- CAAAAGCCCTTTGAAGCCCTG -3'

Sequencing Primer
(F):5'- TTGGGCAAGTCTCAGGCCAG -3'
(R):5'- GTTCTTGTCAAGTGACCACAGCATG -3'
Posted On2014-09-17