Incidental Mutation 'R2077:Tex2'
ID229229
Institutional Source Beutler Lab
Gene Symbol Tex2
Ensembl Gene ENSMUSG00000040548
Gene Nametestis expressed gene 2
SynonymsDef-5, Taz4, 4930568E07Rik
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2077 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location106502147-106613423 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 106506864 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042780]
Predicted Effect probably null
Transcript: ENSMUST00000042780
SMART Domains Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
low complexity region 811 823 N/A INTRINSIC
low complexity region 946 965 N/A INTRINSIC
low complexity region 1003 1016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207249
Meta Mutation Damage Score 0.6148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Tex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tex2 APN 11 106568535 missense probably damaging 1.00
IGL01380:Tex2 APN 11 106544315 nonsense probably null
IGL02607:Tex2 APN 11 106546747 missense unknown
IGL02680:Tex2 APN 11 106568232 unclassified probably benign
IGL02699:Tex2 APN 11 106568433 missense possibly damaging 0.53
IGL03187:Tex2 APN 11 106568077 unclassified probably benign
IGL03398:Tex2 APN 11 106568272 missense probably damaging 1.00
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R1085:Tex2 UTSW 11 106568487 missense probably damaging 0.98
R1491:Tex2 UTSW 11 106503640 missense possibly damaging 0.72
R1664:Tex2 UTSW 11 106567782 unclassified probably benign
R1794:Tex2 UTSW 11 106567902 unclassified probably benign
R1855:Tex2 UTSW 11 106546876 missense possibly damaging 0.87
R2151:Tex2 UTSW 11 106567335 unclassified probably benign
R2175:Tex2 UTSW 11 106503687 missense unknown
R2984:Tex2 UTSW 11 106546663 critical splice donor site probably null
R3156:Tex2 UTSW 11 106533869 critical splice donor site probably null
R3722:Tex2 UTSW 11 106546740 nonsense probably null
R3724:Tex2 UTSW 11 106529330 missense unknown
R3770:Tex2 UTSW 11 106544252 missense unknown
R3771:Tex2 UTSW 11 106546894 missense unknown
R3813:Tex2 UTSW 11 106511944 missense unknown
R3947:Tex2 UTSW 11 106520003 missense unknown
R4206:Tex2 UTSW 11 106567572 unclassified probably benign
R4342:Tex2 UTSW 11 106567006 unclassified probably benign
R4554:Tex2 UTSW 11 106544386 missense unknown
R4896:Tex2 UTSW 11 106568404 missense probably damaging 1.00
R5207:Tex2 UTSW 11 106546840 missense unknown
R5249:Tex2 UTSW 11 106546789 missense unknown
R5257:Tex2 UTSW 11 106567759 unclassified probably benign
R5258:Tex2 UTSW 11 106567759 unclassified probably benign
R5278:Tex2 UTSW 11 106567813 missense probably benign 0.34
R5702:Tex2 UTSW 11 106544395 missense possibly damaging 0.58
R5835:Tex2 UTSW 11 106519913 missense unknown
R6150:Tex2 UTSW 11 106567080 missense probably benign 0.34
R6785:Tex2 UTSW 11 106533950 missense probably damaging 1.00
R6879:Tex2 UTSW 11 106534010 missense unknown
R7038:Tex2 UTSW 11 106511900 critical splice donor site probably null
R7117:Tex2 UTSW 11 106544245 missense unknown
R7336:Tex2 UTSW 11 106548859 missense unknown
R7568:Tex2 UTSW 11 106548736 missense unknown
T0970:Tex2 UTSW 11 106546946 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTTAAACACATCTGCTGGG -3'
(R):5'- ACTTAGTGATCAACCCTTGCC -3'

Sequencing Primer
(F):5'- ACACATCTGCTGGGTTTCTTTG -3'
(R):5'- CTCTGTGGTGCCAGTGCTC -3'
Posted On2014-09-17