Incidental Mutation 'R2077:Cdc42bpb'
ID229234
Institutional Source Beutler Lab
Gene Symbol Cdc42bpb
Ensembl Gene ENSMUSG00000021279
Gene NameCDC42 binding protein kinase beta
SynonymsDMPK-like
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111292976-111377718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111299196 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1434 (L1434P)
Ref Sequence ENSEMBL: ENSMUSP00000042565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041965] [ENSMUST00000220657]
Predicted Effect probably damaging
Transcript: ENSMUST00000041965
AA Change: L1434P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279
AA Change: L1434P

DomainStartEndE-ValueType
S_TKc 76 342 1e-87 SMART
S_TK_X 343 405 5.02e-10 SMART
Pfam:KELK 527 606 4.5e-32 PFAM
low complexity region 628 640 N/A INTRINSIC
coiled coil region 727 815 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Pfam:DMPK_coil 878 939 1.2e-29 PFAM
C1 1027 1076 1.43e-11 SMART
PH 1097 1217 1.19e-6 SMART
CNH 1240 1521 1.32e-10 SMART
low complexity region 1564 1576 N/A INTRINSIC
PBD 1585 1620 7.16e-10 SMART
low complexity region 1681 1696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220619
Predicted Effect probably benign
Transcript: ENSMUST00000220657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222483
Predicted Effect unknown
Transcript: ENSMUST00000222724
AA Change: L230P
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Cdc42bpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Cdc42bpb APN 12 111294096 unclassified probably benign
IGL01360:Cdc42bpb APN 12 111342075 missense probably damaging 1.00
IGL01577:Cdc42bpb APN 12 111302043 missense possibly damaging 0.71
IGL01909:Cdc42bpb APN 12 111323142 missense probably benign
IGL01924:Cdc42bpb APN 12 111317453 unclassified probably benign
IGL02428:Cdc42bpb APN 12 111323127 missense probably benign
IGL02678:Cdc42bpb APN 12 111326096 missense probably damaging 1.00
IGL02792:Cdc42bpb APN 12 111299561 missense probably benign
IGL03367:Cdc42bpb APN 12 111336159 missense probably damaging 1.00
F5770:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
PIT4585001:Cdc42bpb UTSW 12 111304978 missense probably damaging 1.00
R0129:Cdc42bpb UTSW 12 111304959 intron probably benign
R0633:Cdc42bpb UTSW 12 111345555 missense probably damaging 0.99
R1054:Cdc42bpb UTSW 12 111313353 missense probably benign 0.00
R1335:Cdc42bpb UTSW 12 111296441 missense probably damaging 1.00
R1459:Cdc42bpb UTSW 12 111296300 unclassified probably benign
R1780:Cdc42bpb UTSW 12 111322907 missense probably damaging 1.00
R1823:Cdc42bpb UTSW 12 111327559 missense probably damaging 1.00
R1843:Cdc42bpb UTSW 12 111322821 missense probably benign
R1902:Cdc42bpb UTSW 12 111326016 missense probably damaging 1.00
R1945:Cdc42bpb UTSW 12 111299133 missense probably damaging 1.00
R2184:Cdc42bpb UTSW 12 111296044 missense probably damaging 0.99
R2208:Cdc42bpb UTSW 12 111336029 missense probably damaging 1.00
R2211:Cdc42bpb UTSW 12 111301854 missense probably benign 0.11
R2273:Cdc42bpb UTSW 12 111302167 missense probably damaging 1.00
R2406:Cdc42bpb UTSW 12 111302124 missense probably benign 0.00
R3080:Cdc42bpb UTSW 12 111295818 missense probably damaging 0.99
R3612:Cdc42bpb UTSW 12 111303822 intron probably benign
R4106:Cdc42bpb UTSW 12 111295145 missense probably benign 0.01
R4133:Cdc42bpb UTSW 12 111321542 missense probably benign 0.00
R4156:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4202:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4573:Cdc42bpb UTSW 12 111323141 missense probably benign 0.00
R4659:Cdc42bpb UTSW 12 111339891 missense probably damaging 1.00
R5101:Cdc42bpb UTSW 12 111299115 missense probably damaging 1.00
R5591:Cdc42bpb UTSW 12 111323087 missense probably benign 0.01
R5669:Cdc42bpb UTSW 12 111302013 critical splice donor site probably null
R5830:Cdc42bpb UTSW 12 111345582 nonsense probably null
R5872:Cdc42bpb UTSW 12 111325976 missense probably damaging 1.00
R6748:Cdc42bpb UTSW 12 111294839 unclassified probably benign
R6813:Cdc42bpb UTSW 12 111327615 missense probably damaging 1.00
R7024:Cdc42bpb UTSW 12 111326085 missense probably damaging 1.00
R7165:Cdc42bpb UTSW 12 111321517 missense probably damaging 1.00
R7228:Cdc42bpb UTSW 12 111305093 missense possibly damaging 0.92
R7258:Cdc42bpb UTSW 12 111326084 missense probably damaging 1.00
R7352:Cdc42bpb UTSW 12 111299311 missense probably damaging 1.00
R7361:Cdc42bpb UTSW 12 111345605 missense probably damaging 1.00
R7399:Cdc42bpb UTSW 12 111305667 missense probably benign 0.00
R7468:Cdc42bpb UTSW 12 111339873 missense probably damaging 1.00
V7582:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
V7583:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
X0023:Cdc42bpb UTSW 12 111326078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGAACATGCCGGCTG -3'
(R):5'- ACTAAGCCTTTCCACAGGAAGTTC -3'

Sequencing Primer
(F):5'- TGTCCGTGTGAGCAGCAG -3'
(R):5'- CCTTTCCACAGGAAGTTCAGTGAG -3'
Posted On2014-09-17