Incidental Mutation 'R2077:Ltb4r2'
ID229237
Institutional Source Beutler Lab
Gene Symbol Ltb4r2
Ensembl Gene ENSMUSG00000040432
Gene Nameleukotriene B4 receptor 2
SynonymsBLT2, 5830462O07Rik
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2077 (G1)
Quality Score213
Status Validated
Chromosome14
Chromosomal Location55761428-55765138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55761987 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000048358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001497] [ENSMUST00000044554] [ENSMUST00000057569]
Predicted Effect probably benign
Transcript: ENSMUST00000001497
SMART Domains Protein: ENSMUSP00000001497
Gene: ENSMUSG00000022219

DomainStartEndE-ValueType
CAD 36 108 2.16e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044554
AA Change: T22A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048358
Gene: ENSMUSG00000040432
AA Change: T22A

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:7tm_1 37 288 5.7e-31 PFAM
low complexity region 309 323 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057569
SMART Domains Protein: ENSMUSP00000051368
Gene: ENSMUSG00000046908

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 28 196 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 31 249 2e-8 PFAM
Pfam:7tm_1 37 285 1.3e-42 PFAM
Pfam:Serpentine_r_xa 54 201 2.8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228302
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced incidence and severity of autoantibody-induced inflammatory arthritis and decreased susceptibility to IgE antigen-dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Ltb4r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03228:Ltb4r2 APN 14 55761951 missense probably damaging 1.00
R4076:Ltb4r2 UTSW 14 55762941 missense probably benign 0.39
R6221:Ltb4r2 UTSW 14 55762083 missense probably damaging 1.00
R6247:Ltb4r2 UTSW 14 55762651 missense probably damaging 1.00
R6519:Ltb4r2 UTSW 14 55762981 missense probably benign
R6634:Ltb4r2 UTSW 14 55762505 unclassified probably null
R6709:Ltb4r2 UTSW 14 55762533 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACAGGTTCTAAGGAGCTGTTTG -3'
(R):5'- ACACGTAGTACACCGCCTTG -3'

Sequencing Primer
(F):5'- CAGGTTCTAAGGAGCTGTTTGAATTG -3'
(R):5'- TAGTACACCGCCTTGCAGCC -3'
Posted On2014-09-17