Incidental Mutation 'R2078:Abcb6'
ID229251
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms1200005B17Rik
MMRRC Submission 040083-MU
Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75171717-75180392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75172136 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 55 (G55C)
Ref Sequence ENSEMBL: ENSMUSP00000124630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027394] [ENSMUST00000027396] [ENSMUST00000160439] [ENSMUST00000161215] [ENSMUST00000162768]
Predicted Effect probably benign
Transcript: ENSMUST00000027394
SMART Domains Protein: ENSMUSP00000027394
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000027396
AA Change: G800C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: G800C

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160282
Predicted Effect probably benign
Transcript: ENSMUST00000160439
SMART Domains Protein: ENSMUSP00000125086
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161106
Predicted Effect probably damaging
Transcript: ENSMUST00000161215
AA Change: G55C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198
AA Change: G55C

DomainStartEndE-ValueType
SCOP:d1jj7a_ 5 78 8e-23 SMART
Blast:AAA 23 71 9e-25 BLAST
PDB:3NHB|A 23 94 3e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161657
Predicted Effect probably benign
Transcript: ENSMUST00000162768
SMART Domains Protein: ENSMUSP00000124552
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75178002 missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75172111 unclassified probably benign
R0035:Abcb6 UTSW 1 75175007 missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75171909 missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75172679 unclassified probably benign
R1595:Abcb6 UTSW 1 75177300 unclassified probably null
R1912:Abcb6 UTSW 1 75179955 missense probably benign
R3105:Abcb6 UTSW 1 75175043 unclassified probably benign
R4015:Abcb6 UTSW 1 75174491 unclassified probably null
R4604:Abcb6 UTSW 1 75179877 missense probably benign
R4633:Abcb6 UTSW 1 75177782 unclassified probably benign
R4748:Abcb6 UTSW 1 75177358 missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75177912 unclassified probably benign
R5654:Abcb6 UTSW 1 75174835 unclassified probably null
R5841:Abcb6 UTSW 1 75174350 missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75172551 splice site probably null
R6527:Abcb6 UTSW 1 75177488 critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75174137 critical splice donor site probably null
R7278:Abcb6 UTSW 1 75174373 missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75172153 missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75173604 missense probably damaging 1.00
X0009:Abcb6 UTSW 1 75174553 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCCACATCTCGGCATAAACG -3'
(R):5'- ATACATCTAATGAGAGAGCCATCC -3'

Sequencing Primer
(F):5'- GCATAAACGCCACCTCGGG -3'
(R):5'- CCTCTCTGGCCAAAGTCTG -3'
Posted On2014-09-17