Incidental Mutation 'R2078:Dlgap4'
ID229259
Institutional Source Beutler Lab
Gene Symbol Dlgap4
Ensembl Gene ENSMUSG00000061689
Gene NameDLG associated protein 4
SynonymsSAP90/PSD-95-associated protein 4, WBP16, PSD-95/SAP90 binding protein 4, Sapap4, DAP4
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156613705-156764363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156762826 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 261 (S261P)
Ref Sequence ENSEMBL: ENSMUSP00000129756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000094] [ENSMUST00000070782] [ENSMUST00000099145] [ENSMUST00000109566] [ENSMUST00000109567] [ENSMUST00000109568] [ENSMUST00000131157] [ENSMUST00000169464] [ENSMUST00000171030]
Predicted Effect probably benign
Transcript: ENSMUST00000000094
SMART Domains Protein: ENSMUSP00000000094
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 3 232 2.4e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070782
AA Change: S965P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068745
Gene: ENSMUSG00000061689
AA Change: S965P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 638 989 1.2e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099145
AA Change: S429P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096749
Gene: ENSMUSG00000061689
AA Change: S429P

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 61 81 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:GKAP 114 453 2.4e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109566
AA Change: S261P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105194
Gene: ENSMUSG00000061689
AA Change: S261P

DomainStartEndE-ValueType
Pfam:GKAP 1 285 2e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109567
AA Change: S965P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105195
Gene: ENSMUSG00000061689
AA Change: S965P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
Pfam:GKAP 636 989 4.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109568
AA Change: S951P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105196
Gene: ENSMUSG00000061689
AA Change: S951P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 463 480 N/A INTRINSIC
low complexity region 510 537 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 583 603 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Pfam:GKAP 636 975 5.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127944
Predicted Effect probably benign
Transcript: ENSMUST00000131157
SMART Domains Protein: ENSMUSP00000134941
Gene: ENSMUSG00000061689

DomainStartEndE-ValueType
Pfam:GKAP 1 110 2.2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169464
AA Change: S968P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126980
Gene: ENSMUSG00000061689
AA Change: S968P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 660 992 1.5e-148 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171030
AA Change: S261P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129756
Gene: ENSMUSG00000061689
AA Change: S261P

DomainStartEndE-ValueType
Pfam:GKAP 1 266 8.7e-103 PFAM
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Dlgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Dlgap4 APN 2 156711139 missense probably damaging 1.00
IGL02732:Dlgap4 APN 2 156749323 missense probably benign 0.30
IGL02868:Dlgap4 APN 2 156700896 missense probably damaging 1.00
IGL03169:Dlgap4 APN 2 156711018 splice site probably null
IGL03220:Dlgap4 APN 2 156704626 missense probably damaging 1.00
E0374:Dlgap4 UTSW 2 156761843 missense probably damaging 1.00
R0413:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R0573:Dlgap4 UTSW 2 156746191 missense probably benign 0.32
R0645:Dlgap4 UTSW 2 156761879 missense probably damaging 1.00
R0893:Dlgap4 UTSW 2 156745978 nonsense probably null
R1472:Dlgap4 UTSW 2 156760901 nonsense probably null
R1620:Dlgap4 UTSW 2 156749136 nonsense probably null
R1636:Dlgap4 UTSW 2 156746077 nonsense probably null
R2173:Dlgap4 UTSW 2 156762812 missense probably damaging 1.00
R2264:Dlgap4 UTSW 2 156701463 missense probably benign 0.00
R2348:Dlgap4 UTSW 2 156701206 missense possibly damaging 0.80
R3608:Dlgap4 UTSW 2 156748412 intron probably benign
R3872:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3873:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3874:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3897:Dlgap4 UTSW 2 156746069 missense probably damaging 1.00
R5068:Dlgap4 UTSW 2 156707111 missense probably benign
R5286:Dlgap4 UTSW 2 156745919 missense probably damaging 1.00
R5302:Dlgap4 UTSW 2 156760898 missense probably damaging 1.00
R5568:Dlgap4 UTSW 2 156762901 makesense probably null
R5691:Dlgap4 UTSW 2 156704470 missense probably benign
R5741:Dlgap4 UTSW 2 156711048 missense probably damaging 1.00
R5917:Dlgap4 UTSW 2 156704540 missense probably damaging 1.00
R6140:Dlgap4 UTSW 2 156762729 unclassified probably null
R6992:Dlgap4 UTSW 2 156748940 splice site probably null
R7082:Dlgap4 UTSW 2 156748422 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTGGCACCTTTAGTTTATTTCTG -3'
(R):5'- CACATTGTGAGCCCTTGTGTG -3'

Sequencing Primer
(F):5'- GTTCCCTCCTCACTGTCTCAATAAAG -3'
(R):5'- GCTCAGGGTCTCTAGAGATAATAACC -3'
Posted On2014-09-17