Incidental Mutation 'R2078:Rfc5'
ID229270
Institutional Source Beutler Lab
Gene Symbol Rfc5
Ensembl Gene ENSMUSG00000029363
Gene Namereplication factor C (activator 1) 5
Synonyms36.5kDa, 2610209F07Rik, 2610020K06Rik, 36kDa, Recc5
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117378103-117389047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117380803 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 296 (V296A)
Ref Sequence ENSEMBL: ENSMUSP00000083652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031309] [ENSMUST00000086461] [ENSMUST00000111959]
Predicted Effect probably benign
Transcript: ENSMUST00000031309
SMART Domains Protein: ENSMUSP00000031309
Gene: ENSMUSG00000029364

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:WD40 17 54 5e-17 BLAST
WD40 81 139 3.57e0 SMART
WD40 142 182 1.43e-9 SMART
WD40 186 225 1.59e-7 SMART
WD40 228 267 7.16e-10 SMART
WD40 270 321 6.53e-4 SMART
WD40 324 361 6.42e-1 SMART
SOCS 360 403 5.56e-17 SMART
SOCS_box 366 402 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086461
AA Change: V296A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083652
Gene: ENSMUSG00000029363
AA Change: V296A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
AAA 51 179 4.16e-14 SMART
Pfam:Rep_fac_C 241 327 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111959
SMART Domains Protein: ENSMUSP00000107590
Gene: ENSMUSG00000029364

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Blast:WD40 18 56 7e-18 BLAST
WD40 83 141 3.57e0 SMART
WD40 144 184 1.43e-9 SMART
WD40 188 227 1.59e-7 SMART
WD40 230 269 7.16e-10 SMART
WD40 272 323 6.53e-4 SMART
WD40 326 363 6.42e-1 SMART
SOCS 362 405 5.56e-17 SMART
SOCS_box 368 404 1.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150962
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Rfc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rfc5 APN 5 117386866 splice site probably benign
R2431:Rfc5 UTSW 5 117385458 missense probably damaging 1.00
R4787:Rfc5 UTSW 5 117382420 missense probably benign 0.00
R4890:Rfc5 UTSW 5 117386820 missense probably damaging 1.00
R6385:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6386:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6963:Rfc5 UTSW 5 117387866 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCAGACGACCTGCATG -3'
(R):5'- TCTCATGATCTGTATGCATGGGTC -3'

Sequencing Primer
(F):5'- TGCGCTCATCATCCTCACACAG -3'
(R):5'- ATGCATGGGTCTGAGGGATGC -3'
Posted On2014-09-17