Incidental Mutation 'R2078:Exoc4'
ID229274
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Nameexocyst complex component 4
SynonymsSec8l1, Sec8
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location33249085-33973979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33910587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 770 (D770G)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
Predicted Effect probably benign
Transcript: ENSMUST00000052266
AA Change: D770G

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: D770G

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCGAGTAGTGAAAACAGC -3'
(R):5'- TGCTAAACATCAAGCTCAGGATAAG -3'

Sequencing Primer
(F):5'- AGCAAGATGACTGGATACTCTAC -3'
(R):5'- CATCAAGCTCAGGATAAGAACAG -3'
Posted On2014-09-17