Incidental Mutation 'R2078:Terf2ip'
ID229283
Institutional Source Beutler Lab
Gene Symbol Terf2ip
Ensembl Gene ENSMUSG00000033430
Gene Nametelomeric repeat binding factor 2, interacting protein
SynonymsRap1
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location112011398-112020528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112015403 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 243 (N243S)
Ref Sequence ENSEMBL: ENSMUSP00000052170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000052138] [ENSMUST00000071732] [ENSMUST00000093120] [ENSMUST00000164470] [ENSMUST00000211990]
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052138
AA Change: N243S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: N243S

DomainStartEndE-ValueType
Pfam:BRCT_2 17 100 1.4e-23 PFAM
Pfam:Myb_DNA-bind_2 129 193 3.9e-35 PFAM
low complexity region 279 298 N/A INTRINSIC
Pfam:Rap1_C 315 392 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071732
SMART Domains Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

DomainStartEndE-ValueType
RRM 14 86 3.1e-26 SMART
RRM 105 177 8.1e-24 SMART
low complexity region 192 310 N/A INTRINSIC
low complexity region 321 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211978
Predicted Effect probably benign
Transcript: ENSMUST00000211990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212732
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Terf2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Terf2ip APN 8 112012068 missense probably benign
R0244:Terf2ip UTSW 8 112018164 missense possibly damaging 0.73
R0544:Terf2ip UTSW 8 112015342 missense possibly damaging 0.88
R0617:Terf2ip UTSW 8 112011495 missense probably benign 0.10
R0976:Terf2ip UTSW 8 112011717 missense probably damaging 0.98
R1709:Terf2ip UTSW 8 112011606 frame shift probably null
R2134:Terf2ip UTSW 8 112011639 missense possibly damaging 0.71
R4572:Terf2ip UTSW 8 112012017 missense probably damaging 1.00
R6172:Terf2ip UTSW 8 112018017 missense probably damaging 1.00
R6266:Terf2ip UTSW 8 112011915 missense probably damaging 1.00
R6563:Terf2ip UTSW 8 112018202 missense probably damaging 1.00
R7180:Terf2ip UTSW 8 112011420 unclassified probably benign
R7203:Terf2ip UTSW 8 112017986 missense probably benign 0.30
R7222:Terf2ip UTSW 8 112011915 missense possibly damaging 0.64
R7304:Terf2ip UTSW 8 112011648 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATTGAGTATGCATCTCTTACGCTC -3'
(R):5'- GCCTAAAGCCAGGTCACATC -3'

Sequencing Primer
(F):5'- GTATGCATCTCTTACGCTCTCTGTAC -3'
(R):5'- GCCTAAAGCCAGGTCACATCTATTTC -3'
Posted On2014-09-17