Incidental Mutation 'R2078:Acss3'
ID229291
Institutional Source Beutler Lab
Gene Symbol Acss3
Ensembl Gene ENSMUSG00000035948
Gene Nameacyl-CoA synthetase short-chain family member 3
SynonymsLOC380660, 8430416H19Rik
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location106933517-107123668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106967041 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 448 (T448A)
Ref Sequence ENSEMBL: ENSMUSP00000128209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044668] [ENSMUST00000165067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044668
AA Change: T448A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040823
Gene: ENSMUSG00000035948
AA Change: T448A

DomainStartEndE-ValueType
Pfam:AMP-binding 112 496 4.6e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165067
AA Change: T448A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948
AA Change: T448A

DomainStartEndE-ValueType
Pfam:ACAS_N 57 111 8.8e-22 PFAM
Pfam:AMP-binding 113 557 3.2e-81 PFAM
Pfam:AMP-binding_C 565 644 2.2e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Acss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Acss3 APN 10 106966026 missense probably benign
IGL00941:Acss3 APN 10 107053326 critical splice donor site probably null
IGL00983:Acss3 APN 10 106966964 nonsense probably null
IGL01010:Acss3 APN 10 107023849 splice site probably benign
IGL02227:Acss3 APN 10 107045335 missense probably benign
IGL02296:Acss3 APN 10 107053451 nonsense probably null
IGL02319:Acss3 APN 10 106948750 missense probably damaging 0.99
IGL03181:Acss3 APN 10 107053388 missense probably damaging 1.00
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0279:Acss3 UTSW 10 107084871 missense possibly damaging 0.95
R0418:Acss3 UTSW 10 107023912 missense probably damaging 0.99
R0550:Acss3 UTSW 10 107053471 missense probably damaging 1.00
R1114:Acss3 UTSW 10 106988879 missense possibly damaging 0.89
R1491:Acss3 UTSW 10 106937308 missense probably benign
R1625:Acss3 UTSW 10 106937402 critical splice donor site probably null
R1771:Acss3 UTSW 10 106937200 missense probably damaging 1.00
R1956:Acss3 UTSW 10 106936168 missense probably benign 0.00
R2006:Acss3 UTSW 10 106963010 missense possibly damaging 0.81
R2018:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2019:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2253:Acss3 UTSW 10 107004748 missense probably damaging 1.00
R2391:Acss3 UTSW 10 107123487 missense probably benign 0.00
R3082:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R3083:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R4072:Acss3 UTSW 10 107123585 unclassified probably benign
R4086:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4087:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4089:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4090:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4406:Acss3 UTSW 10 107053337 missense probably damaging 1.00
R4607:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4608:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4790:Acss3 UTSW 10 107023702 nonsense probably null
R4834:Acss3 UTSW 10 107084805 critical splice donor site probably null
R5130:Acss3 UTSW 10 107004725 missense possibly damaging 0.87
R5303:Acss3 UTSW 10 107084851 missense possibly damaging 0.74
R5365:Acss3 UTSW 10 107004728 missense probably damaging 1.00
R5439:Acss3 UTSW 10 106937147 nonsense probably null
R5617:Acss3 UTSW 10 106951990 missense probably damaging 1.00
R5698:Acss3 UTSW 10 106948744 missense probably damaging 1.00
R5726:Acss3 UTSW 10 107123322 missense possibly damaging 0.63
R6154:Acss3 UTSW 10 107123349 missense probably benign 0.02
R6298:Acss3 UTSW 10 107084856 missense probably damaging 1.00
R6592:Acss3 UTSW 10 107023718 missense possibly damaging 0.94
R6707:Acss3 UTSW 10 107084922 missense probably damaging 1.00
R6999:Acss3 UTSW 10 107053501 missense probably damaging 1.00
R7567:Acss3 UTSW 10 107123313 missense probably benign 0.00
X0027:Acss3 UTSW 10 107123344 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTACGACTGTCTTGAAAGCAAATAC -3'
(R):5'- AAAGCTCTGTTAAAGGTTGAGTGAGTC -3'

Sequencing Primer
(F):5'- CCATTGTATCCTGGAACACA -3'
(R):5'- TTAAAGGTTGAGTGAGTCTGATTTC -3'
Posted On2014-09-17