Mutagenetix > Incidental Mutations

Incidental Mutation 'R2079:Kmt2c'

229328

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

040084-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.881) question?

Stock #

R2079 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25352280 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1143 (D1143G)

Ref Sequence

ENSEMBL: ENSMUSP00000043874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045291
AA Change: D1143G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: D1143G

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173073
AA Change: D1103G

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: D1103G

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	858	870	1.41e2	SMART
PHD	913	962	2.89e-10	SMART
RING	914	961	4.74e0	SMART
C1	954	1005	8.38e-2	SMART
PHD	963	1009	1.05e-12	SMART
PHD	1040	1091	2.08e-2	SMART
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1297	1308	N/A	INTRINSIC
low complexity region	1354	1366	N/A	INTRINSIC
low complexity region	1445	1464	N/A	INTRINSIC
low complexity region	1482	1495	N/A	INTRINSIC
HMG	1564	1628	2.64e-3	SMART
low complexity region	1633	1649	N/A	INTRINSIC
coiled coil region	1670	1714	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	A	T	13: 104,462,238	R862S	probably benign	Het
Aldoa	T	C	7: 126,796,904	D164G	probably null	Het
Ankle2	T	C	5: 110,244,505	V459A	probably damaging	Het
Atp11a	A	G	8: 12,857,902	Y482C	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Cfap65	G	A	1: 74,917,199	R1074C	probably benign	Het
Ciart	G	T	3: 95,879,038	H242N	probably damaging	Het
Cidec	T	A	6: 113,425,654	M220L	probably benign	Het
Clca1	A	G	3: 145,007,773	I699T	possibly damaging	Het
Csf2rb2	T	C	15: 78,288,007	D401G	probably benign	Het
Cyp2j6	C	A	4: 96,531,725	L256F	possibly damaging	Het
Ddr2	A	T	1: 170,004,776	Y148*	probably null	Het
Depdc5	T	A	5: 32,946,674	I373N	possibly damaging	Het
Dpp10	A	T	1: 123,432,992	M268K	probably damaging	Het
Fam118b	C	A	9: 35,223,664	V216F	possibly damaging	Het
Fam71b	T	G	11: 46,405,107	V102G	probably benign	Het
Fancd2	T	C	6: 113,555,187	V487A	probably damaging	Het
Fhad1	T	A	4: 141,991,202	R147*	probably null	Het
Flt3	A	G	5: 147,355,083	S544P	probably damaging	Het
Frem3	C	A	8: 80,615,103	Q1342K	probably benign	Het
Gimap4	T	C	6: 48,690,947	M84T	possibly damaging	Het
Gm20481	T	C	17: 34,970,220	K569R	probably benign	Het
Gm4871	A	C	5: 145,029,931	D247E	possibly damaging	Het
Gm5141	A	T	13: 62,774,610	N248K	probably benign	Het
Gulo	A	G	14: 65,990,383	Y367H	probably damaging	Het
Hap1	T	C	11: 100,353,746	E120G	probably damaging	Het
Heatr3	T	A	8: 88,141,776	N51K	probably damaging	Het
Hipk2	T	C	6: 38,818,785	D183G	probably damaging	Het
Hnrnpll	T	A	17: 80,035,377	T439S	probably benign	Het
Hoxd3	A	C	2: 74,744,266	E85D	probably damaging	Het
Ipo8	A	T	6: 148,789,162	M694K	probably damaging	Het
Jag2	A	G	12: 112,920,377	I194T	probably damaging	Het
Jrkl	A	T	9: 13,244,859	F266I	probably damaging	Het
Kcnt1	A	G	2: 25,900,248	I436V	possibly damaging	Het
Kdm3b	A	T	18: 34,803,517	D284V	probably damaging	Het
Khdrbs2	A	G	1: 32,467,874	T200A	probably benign	Het
Kremen1	G	GGGGT	11: 5,201,794		probably null	Het
Lama2	A	C	10: 27,369,053	I244S	probably damaging	Het
Lama5	G	A	2: 180,225,508	P99S	possibly damaging	Het
Lrrc30	A	T	17: 67,631,880	L235Q	possibly damaging	Het
Man2b2	C	T	5: 36,814,372	V667M	possibly damaging	Het
Mmp2	T	A	8: 92,850,189	N77K	probably damaging	Het
Myo1a	A	G	10: 127,720,613	E1009G	probably benign	Het
Ndst1	A	G	18: 60,695,509	Y658H	probably damaging	Het
Nlrp10	A	G	7: 108,925,628	L215P	possibly damaging	Het
Nrbp1	T	C	5: 31,251,073	F526L	probably benign	Het
Olfr574	T	A	7: 102,949,495	F333L	probably benign	Het
Olfr763	T	C	10: 129,012,029	V248A	probably damaging	Het
Padi2	T	C	4: 140,933,196	L329P	probably damaging	Het
Pcdhb20	A	G	18: 37,505,171	Q250R	probably benign	Het
Pcdhb3	T	A	18: 37,303,309	L776Q	possibly damaging	Het
Pik3cb	A	T	9: 99,060,204	M700K	probably benign	Het
Pla2g6	C	T	15: 79,312,994	V127M	probably damaging	Het
Rabgef1	T	C	5: 130,190,935	S80P	probably damaging	Het
Sema3a	C	T	5: 13,451,131	T47I	possibly damaging	Het
Sik2	C	T	9: 50,907,406		probably null	Het
Sin3a	T	C	9: 57,089,523	V112A	probably benign	Het
Slc26a6	G	A	9: 108,859,058	A472T	probably damaging	Het
Syne1	A	G	10: 5,361,502	V561A	probably benign	Het
Syt16	C	T	12: 74,238,299	T422I	probably damaging	Het
Tlr11	A	T	14: 50,360,980	H141L	probably damaging	Het
Tmem252	A	T	19: 24,677,653	E131D	probably benign	Het
Trim55	T	G	3: 19,644,666	L20V	probably damaging	Het
Uqcrfs1	A	T	13: 30,541,308	V83D	probably benign	Het
Utf1	C	T	7: 139,944,895	R309*	probably null	Het
Uxs1	T	C	1: 43,764,973	T261A	probably damaging	Het
Vmn1r24	T	C	6: 57,955,670	I288V	probably benign	Het
Vmn1r80	A	T	7: 12,193,194	D77V	probably damaging	Het
Vmn2r74	T	G	7: 85,957,175	H321P	probably benign	Het
Zfp638	T	C	6: 83,953,389		probably null	Het
Zwilch	T	A	9: 64,153,574	Q332L	probably damaging	Het
Zwilch	G	T	9: 64,153,575	Q332K	probably damaging	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0616:Kmt2c	UTSW	5	25299252	missense	probably benign
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1110:Kmt2c	UTSW	5	25314362	missense	probably benign	0.01
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5093:Kmt2c	UTSW	5	25409207	missense	probably benign	0.17
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TACCCAGCTGAAGTGAAGGC -3'
(R):5'- GTTGGCATACACAAACGCTC -3'

Sequencing Primer
(F):5'- GGCAAGCAAGATACTAACAGTTAATC -3'
(R):5'- GCATACACAAACGCTCTCCCC -3'

Posted On

2014-09-17