Incidental Mutation 'R2079:Kmt2c'
ID229328
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Namelysine (K)-specific methyltransferase 2C
SynonymsMll3, E330008K23Rik, HALR
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location25271798-25498783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25352280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1143 (D1143G)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045291
AA Change: D1143G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: D1143G

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173073
AA Change: D1103G

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: D1103G

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0671:Kmt2c UTSW 5 25404365 missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25285079 missense probably damaging 1.00
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R4983:Kmt2c UTSW 5 25295511 missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TACCCAGCTGAAGTGAAGGC -3'
(R):5'- GTTGGCATACACAAACGCTC -3'

Sequencing Primer
(F):5'- GGCAAGCAAGATACTAACAGTTAATC -3'
(R):5'- GCATACACAAACGCTCTCCCC -3'
Posted On2014-09-17