Incidental Mutation 'R2079:Gimap4'
ID229339
Institutional Source Beutler Lab
Gene Symbol Gimap4
Ensembl Gene ENSMUSG00000054435
Gene NameGTPase, IMAP family member 4
SynonymsIan1, E430007K16Rik
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48684549-48692060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48690947 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 84 (M84T)
Ref Sequence ENSEMBL: ENSMUSP00000112530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067506] [ENSMUST00000090070] [ENSMUST00000118802] [ENSMUST00000119575] [ENSMUST00000121957] [ENSMUST00000156770]
Predicted Effect probably benign
Transcript: ENSMUST00000067506
AA Change: M212T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068398
Gene: ENSMUSG00000054435
AA Change: M212T

DomainStartEndE-ValueType
Pfam:AIG1 31 218 4.2e-72 PFAM
Pfam:MMR_HSR1 32 186 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090070
AA Change: M212T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087524
Gene: ENSMUSG00000054435
AA Change: M212T

DomainStartEndE-ValueType
Pfam:AIG1 31 242 1.5e-80 PFAM
Pfam:MMR_HSR1 32 170 1.6e-10 PFAM
low complexity region 265 282 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118802
AA Change: M84T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112530
Gene: ENSMUSG00000054435
AA Change: M84T

DomainStartEndE-ValueType
Pfam:AIG1 31 53 1.6e-7 PFAM
Pfam:AIG1 48 114 6.4e-17 PFAM
low complexity region 137 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119575
SMART Domains Protein: ENSMUSP00000113989
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
SCOP:d1zin_1 31 50 2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121957
AA Change: M84T
SMART Domains Protein: ENSMUSP00000113016
Gene: ENSMUSG00000054435
AA Change: M84T

DomainStartEndE-ValueType
Pfam:AIG1 31 55 4.3e-8 PFAM
Pfam:AIG1 48 89 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156770
SMART Domains Protein: ENSMUSP00000122070
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 69 6.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show no detectable alterations in T-cell development, selection and activation; however, mutant T cells exhibit a delay in the execution of programmed cell death induced by intrinsic stimuli downstream of caspase-3 activation and phosphatidylserine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Gimap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gimap4 APN 6 48690938 missense probably damaging 1.00
IGL01917:Gimap4 APN 6 48690920 missense probably benign 0.02
IGL02302:Gimap4 APN 6 48690413 missense probably damaging 1.00
IGL02679:Gimap4 APN 6 48690495 nonsense probably null
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1584:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R2118:Gimap4 UTSW 6 48690971 missense probably benign 0.24
R2566:Gimap4 UTSW 6 48690865 missense probably damaging 1.00
R4279:Gimap4 UTSW 6 48690577 missense probably benign 0.22
R5592:Gimap4 UTSW 6 48691158 missense probably damaging 0.99
R5597:Gimap4 UTSW 6 48690764 missense probably damaging 1.00
R6162:Gimap4 UTSW 6 48690721 missense probably damaging 0.97
R6354:Gimap4 UTSW 6 48686880 missense possibly damaging 0.53
R6658:Gimap4 UTSW 6 48691404 missense possibly damaging 0.65
X0050:Gimap4 UTSW 6 48690800 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGCTCACCAGGAAGGATGAC -3'
(R):5'- GTAAAGATAGCCTCCCTCTCCTTG -3'

Sequencing Primer
(F):5'- GGATGACTTAGAAGACACTGATATCC -3'
(R):5'- AAGATAGCCTCCCTCTCCTTGAATTC -3'
Posted On2014-09-17