Incidental Mutation 'R2079:Mmp2'
ID229356
Institutional Source Beutler Lab
Gene Symbol Mmp2
Ensembl Gene ENSMUSG00000031740
Gene Namematrix metallopeptidase 2
Synonymsgelatinase A, 72kDa gelatinase, Clg4a, GelA, MMP-2, 72kDa type IV collagenase
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92827291-92853420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92850189 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 77 (N77K)
Ref Sequence ENSEMBL: ENSMUSP00000147838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034187] [ENSMUST00000211567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034187
AA Change: N613K

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034187
Gene: ENSMUSG00000031740
AA Change: N613K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:PG_binding_1 43 97 2.4e-9 PFAM
ZnMc 115 447 1.06e-49 SMART
FN2 226 274 2.88e-25 SMART
FN2 284 332 5.17e-27 SMART
FN2 342 390 3.33e-30 SMART
HX 477 520 1.13e-4 SMART
HX 522 565 1.33e-10 SMART
HX 570 617 2.21e-16 SMART
HX 619 662 4.29e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211308
Predicted Effect probably damaging
Transcript: ENSMUST00000211567
AA Change: N77K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211691
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that hydrolyzes collagens, gelatins, laminin, fibronectin and elastin. Mice lacking the encoded protein exhibit suppressed angiogenesis and attenuated features of human multicentric osteolysis with arthritis including abnormal skeletal and craniofacial development. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit slightly delayed growth, reduced neovascularization, retarded tumor progression, an exaggerated asthma response to allergens, and impaired branching morphogenesis of the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Mmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Mmp2 APN 8 92830684 missense probably benign
IGL02165:Mmp2 APN 8 92833219 missense probably null 1.00
IGL02424:Mmp2 APN 8 92836007 missense probably damaging 1.00
IGL02478:Mmp2 APN 8 92852607 missense possibly damaging 0.50
IGL03351:Mmp2 APN 8 92839342 missense probably benign 0.00
R2012:Mmp2 UTSW 8 92850203 missense probably benign 0.00
R2034:Mmp2 UTSW 8 92836912 missense probably damaging 1.00
R5090:Mmp2 UTSW 8 92852574 missense probably damaging 1.00
R5103:Mmp2 UTSW 8 92831785 nonsense probably null
R5357:Mmp2 UTSW 8 92833152 missense possibly damaging 0.73
R6902:Mmp2 UTSW 8 92836917 missense probably damaging 0.97
R6925:Mmp2 UTSW 8 92839382 missense probably damaging 1.00
R7057:Mmp2 UTSW 8 92831705 missense probably damaging 1.00
X0065:Mmp2 UTSW 8 92827739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCCACGTCTTATTCCC -3'
(R):5'- TCTAGGTCTTACAGCCTGGAG -3'

Sequencing Primer
(F):5'- GGCCACGTCTTATTCCCTGGAC -3'
(R):5'- TGCCTTCCCAGCACTGAG -3'
Posted On2014-09-17