Incidental Mutation 'R2079:Sin3a'
ID229360
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57089523 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 112 (V112A)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678] [ENSMUST00000169879]
Predicted Effect probably benign
Transcript: ENSMUST00000049169
AA Change: V112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163400
SMART Domains Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

DomainStartEndE-ValueType
Pfam:PAH 82 128 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167715
AA Change: V112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168177
AA Change: V112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168502
AA Change: V112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168678
AA Change: V112A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169879
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTAGATGCATTTGGGAGAGAATG -3'
(R):5'- TGTATGTTCCTCTGGATCAGGC -3'

Sequencing Primer
(F):5'- GCAACAAGCCTTAGTTTGTCTG -3'
(R):5'- CCCTCTCTCTTAAGTTAAGG -3'
Posted On2014-09-17