Incidental Mutation 'R2079:Pcdhb20'
ID229390
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37505171 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 250 (Q250R)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000052179
AA Change: Q250R

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: Q250R

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGTTCTGGACAAAGC -3'
(R):5'- AAAGACCTCCACCATCTGTTGC -3'

Sequencing Primer
(F):5'- CTGGTTCTGGACAAAGCTTTAGATC -3'
(R):5'- CCATCTGTTGCTTGGATATTTACAG -3'
Posted On2014-09-17