Incidental Mutation 'R2080:Dsel'
ID229396
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Namedermatan sulfate epimerase-like
Synonyms9330132E09Rik, DS-epi2
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location111858702-111864918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111859962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 948 (T948A)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
Predicted Effect probably benign
Transcript: ENSMUST00000035462
AA Change: T948A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: T948A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189731
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111860061 nonsense probably null
IGL01562:Dsel APN 1 111860319 missense probably benign
IGL01591:Dsel APN 1 111859695 missense probably benign 0.08
IGL01822:Dsel APN 1 111861896 missense probably damaging 1.00
IGL02289:Dsel APN 1 111860102 nonsense probably null
IGL02557:Dsel APN 1 111862570 missense probably damaging 1.00
IGL02805:Dsel APN 1 111862316 missense probably damaging 1.00
IGL02864:Dsel APN 1 111859214 missense probably damaging 1.00
IGL02887:Dsel APN 1 111860732 missense possibly damaging 0.90
IGL03092:Dsel APN 1 111860063 missense probably damaging 1.00
IGL03117:Dsel APN 1 111859178 utr 3 prime probably benign
IGL03182:Dsel APN 1 111860138 missense probably damaging 0.99
rudolph UTSW 1 111859817 missense probably damaging 0.99
R0196:Dsel UTSW 1 111861603 missense possibly damaging 0.86
R0465:Dsel UTSW 1 111862262 missense probably benign 0.00
R0725:Dsel UTSW 1 111859952 missense possibly damaging 0.79
R1024:Dsel UTSW 1 111860673 missense probably damaging 1.00
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1654:Dsel UTSW 1 111862512 missense probably damaging 1.00
R1728:Dsel UTSW 1 111859457 missense probably benign
R1728:Dsel UTSW 1 111859994 missense probably benign
R1729:Dsel UTSW 1 111859457 missense probably benign
R1729:Dsel UTSW 1 111859994 missense probably benign
R1730:Dsel UTSW 1 111859457 missense probably benign
R1730:Dsel UTSW 1 111859994 missense probably benign
R1735:Dsel UTSW 1 111860915 missense probably damaging 1.00
R1739:Dsel UTSW 1 111859457 missense probably benign
R1739:Dsel UTSW 1 111859994 missense probably benign
R1762:Dsel UTSW 1 111859457 missense probably benign
R1762:Dsel UTSW 1 111859994 missense probably benign
R1783:Dsel UTSW 1 111859457 missense probably benign
R1783:Dsel UTSW 1 111859994 missense probably benign
R1785:Dsel UTSW 1 111859457 missense probably benign
R1785:Dsel UTSW 1 111859994 missense probably benign
R2049:Dsel UTSW 1 111859457 missense probably benign
R2141:Dsel UTSW 1 111859457 missense probably benign
R2142:Dsel UTSW 1 111859457 missense probably benign
R2150:Dsel UTSW 1 111860257 missense probably benign 0.04
R4324:Dsel UTSW 1 111861393 missense probably damaging 1.00
R5378:Dsel UTSW 1 111862821 start gained probably benign
R5881:Dsel UTSW 1 111859438 missense probably damaging 1.00
R5919:Dsel UTSW 1 111860253 missense probably benign
R6820:Dsel UTSW 1 111859817 missense probably damaging 0.99
R7003:Dsel UTSW 1 111860295 missense probably benign
R7064:Dsel UTSW 1 111862847 start gained probably benign
R7297:Dsel UTSW 1 111861776 missense probably damaging 1.00
R7340:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7341:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7343:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7346:Dsel UTSW 1 111861068 missense probably damaging 1.00
R7347:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7365:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7366:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7367:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7393:Dsel UTSW 1 111861573 missense probably damaging 1.00
X0057:Dsel UTSW 1 111859210 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAAGCTTCAATGTCCAGCTACC -3'
(R):5'- CAGAATTCCTACAGCCTACATGG -3'

Sequencing Primer
(F):5'- ATGTCCAGCTACCACTACTTAAGCTG -3'
(R):5'- GCCTACATGGATATCCCTGAAACTG -3'
Posted On2014-09-17