Incidental Mutation 'R2080:Tmem59'
ID229407
Institutional Source Beutler Lab
Gene Symbol Tmem59
Ensembl Gene ENSMUSG00000028618
Gene Nametransmembrane protein 59
Synonyms3110046P06Rik, thymic dendritic cell-derived factor 1, D4Ertd20e, 1110001M20Rik, MTDCF1
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107178399-107200996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107178774 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 16 (L16I)
Ref Sequence ENSEMBL: ENSMUSP00000119701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030361] [ENSMUST00000030362] [ENSMUST00000057043] [ENSMUST00000058585] [ENSMUST00000106753] [ENSMUST00000127720] [ENSMUST00000128123] [ENSMUST00000141165] [ENSMUST00000154007]
Predicted Effect probably benign
Transcript: ENSMUST00000030361
AA Change: L16I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030361
Gene: ENSMUSG00000028618
AA Change: L16I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:BSMAP 72 256 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030362
SMART Domains Protein: ENSMUSP00000030362
Gene: ENSMUSG00000028619

DomainStartEndE-ValueType
Pfam:Med26 60 111 7.9e-20 PFAM
Pfam:TFIIS_M 126 207 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057043
SMART Domains Protein: ENSMUSP00000059741
Gene: ENSMUSG00000028619

DomainStartEndE-ValueType
Pfam:Med26 60 111 7.9e-20 PFAM
Pfam:TFIIS_M 126 207 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058585
SMART Domains Protein: ENSMUSP00000054142
Gene: ENSMUSG00000028619

DomainStartEndE-ValueType
Pfam:Med26 61 110 5.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106753
AA Change: L16I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102364
Gene: ENSMUSG00000028618
AA Change: L16I

DomainStartEndE-ValueType
Pfam:BSMAP 32 189 2.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127652
Predicted Effect probably benign
Transcript: ENSMUST00000127720
Predicted Effect probably benign
Transcript: ENSMUST00000128123
SMART Domains Protein: ENSMUSP00000120288
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 18 127 1.7e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141013
Predicted Effect probably benign
Transcript: ENSMUST00000141165
SMART Domains Protein: ENSMUSP00000115005
Gene: ENSMUSG00000028619

DomainStartEndE-ValueType
Pfam:Med26 60 111 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147375
Predicted Effect probably damaging
Transcript: ENSMUST00000154007
AA Change: L16I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119701
Gene: ENSMUSG00000028618
AA Change: L16I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein shown to regulate autophagy in response to bacterial infection. This protein may also regulate the retention of amyloid precursor protein (APP) in the Golgi apparatus through its control of APP glycosylation. Overexpression of this protein has been found to promote apoptosis in a glioma cell line. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele display reduced dendritic arborization, reduced miniature excitatory postsynaptic currents, and impaired memory formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Tmem59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02663:Tmem59 APN 4 107197541 missense probably damaging 1.00
IGL02695:Tmem59 APN 4 107193314 missense probably benign 0.00
IGL02699:Tmem59 APN 4 107192538 missense probably benign 0.01
IGL02937:Tmem59 APN 4 107197585 missense probably damaging 1.00
R0945:Tmem59 UTSW 4 107187725 splice site probably benign
R4621:Tmem59 UTSW 4 107190718 intron probably benign
R4622:Tmem59 UTSW 4 107190718 intron probably benign
R4623:Tmem59 UTSW 4 107190718 intron probably benign
R4819:Tmem59 UTSW 4 107187681 nonsense probably null
R5413:Tmem59 UTSW 4 107200462 missense probably benign 0.00
R5866:Tmem59 UTSW 4 107190557 missense probably damaging 0.99
R6073:Tmem59 UTSW 4 107193401 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGAGGTTTTCCGTCCCAGAGAC -3'
(R):5'- GCACAAACTTCCGGCAATTTC -3'

Sequencing Primer
(F):5'- CAGGAGGCAGCCGATTG -3'
(R):5'- GCACAGCTTCACCACTAGGG -3'
Posted On2014-09-17