Incidental Mutation 'R2080:L3hypdh'
ID229432
Institutional Source Beutler Lab
Gene Symbol L3hypdh
Ensembl Gene ENSMUSG00000019718
Gene NameL-3-hydroxyproline dehydratase (trans-)
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72073428-72085439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72079527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 213 (V213E)
Ref Sequence ENSEMBL: ENSMUSP00000019862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019862]
Predicted Effect probably damaging
Transcript: ENSMUST00000019862
AA Change: V213E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019862
Gene: ENSMUSG00000019718
AA Change: V213E

DomainStartEndE-ValueType
Pfam:Pro_racemase 22 352 8.7e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138029
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dehydratase that converts trans-3-hydroxy-L-proline to delta(1)-pyrroline-2-carboxylate. This enzyme may function to degrade dietary proteins that contain trans-3-hydroxy-L-proline as well as other proteins such as collagen IV. The encoded protein can be converted to an epimerase by changing a threonine to a cysteine at a catalytic site. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in L3hypdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:L3hypdh APN 12 72077143 critical splice donor site probably null
IGL02718:L3hypdh APN 12 72084856 missense probably damaging 1.00
R0128:L3hypdh UTSW 12 72077143 critical splice donor site probably null
R1109:L3hypdh UTSW 12 72073996 missense possibly damaging 0.93
R1689:L3hypdh UTSW 12 72084753 missense probably damaging 1.00
R2274:L3hypdh UTSW 12 72084858 missense possibly damaging 0.95
R4003:L3hypdh UTSW 12 72085116 missense probably benign 0.00
R4358:L3hypdh UTSW 12 72077424 missense probably damaging 1.00
R4760:L3hypdh UTSW 12 72077242 missense probably benign 0.05
R4825:L3hypdh UTSW 12 72077393 missense probably benign 0.00
R5926:L3hypdh UTSW 12 72077185 missense probably damaging 1.00
R7223:L3hypdh UTSW 12 72074009 missense possibly damaging 0.71
X0028:L3hypdh UTSW 12 72079494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTTTTCAGTGTCAAAGCTGGAAC -3'
(R):5'- CGGAATTAACGCAATGTGATGTG -3'

Sequencing Primer
(F):5'- GCTGGAACTCACAAGGGTC -3'
(R):5'- ACATTGCATATGGTGGGG -3'
Posted On2014-09-17