Incidental Mutation 'R2080:Hist1h1a'
ID229434
Institutional Source Beutler Lab
Gene Symbol Hist1h1a
Ensembl Gene ENSMUSG00000049539
Gene Namehistone cluster 1, H1a
SynonymsH1a, H1f1, H1.1, H1var3
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23763666-23764406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23763949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 78 (N78S)
Ref Sequence ENSEMBL: ENSMUSP00000062030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055770] [ENSMUST00000091701] [ENSMUST00000102964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055770
AA Change: N78S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062030
Gene: ENSMUSG00000049539
AA Change: N78S

DomainStartEndE-ValueType
H15 36 101 3.22e-22 SMART
low complexity region 120 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091701
SMART Domains Protein: ENSMUSP00000089293
Gene: ENSMUSG00000069265

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102964
SMART Domains Protein: ENSMUSP00000100029
Gene: ENSMUSG00000060093

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any defects in the reproductive system or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Hist1h1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0414:Hist1h1a UTSW 13 23764158 unclassified probably benign
R5316:Hist1h1a UTSW 13 23764102 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTACTGCCACGGAGAAACC -3'
(R):5'- AGTCTTCTTAGCTGCAGCCC -3'

Sequencing Primer
(F):5'- ACGGAGAAACCTGCTGCTG -3'
(R):5'- AGCCCCAGCAGTCTTCTTAGG -3'
Posted On2014-09-17