Incidental Mutation 'R2080:Ednrb'
ID229438
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Nameendothelin receptor type B
SynonymsETb, ETR-b, Sox10m1
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103814625-103844402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103843100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: I126N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: I126N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
gus-gus UTSW 14 103820013 missense probably damaging 1.00
pongo UTSW 14 103823274 splice site probably null
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2102:Ednrb UTSW 14 103820914 nonsense probably null
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5688:Ednrb UTSW 14 103823395 missense probably damaging 1.00
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R5834:Ednrb UTSW 14 103820877 missense probably damaging 1.00
R7212:Ednrb UTSW 14 103843008 missense probably damaging 0.96
R7368:Ednrb UTSW 14 103820017 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTACAACCCCACCTTTG -3'
(R):5'- GGTAATGACGCCACCCACTAAG -3'

Sequencing Primer
(F):5'- ACCTTTGGTTTCCAGATCCTCAG -3'
(R):5'- AGAGGTTCCAACTCCAGTCTGATG -3'
Posted On2014-09-17