Incidental Mutation 'R2080:Ppm1f'
ID229440
Institutional Source Beutler Lab
Gene Symbol Ppm1f
Ensembl Gene ENSMUSG00000026181
Gene Nameprotein phosphatase 1F (PP2C domain containing)
Synonyms4933427B07Rik, 1110021B16Rik
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16896469-16927364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16923880 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 406 (M406K)
Ref Sequence ENSEMBL: ENSMUSP00000027373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027373
AA Change: M406K

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: M406K

DomainStartEndE-ValueType
Blast:PP2Cc 25 97 1e-16 BLAST
low complexity region 99 110 N/A INTRINSIC
PP2Cc 141 408 3.14e-79 SMART
PP2C_SIG 168 410 5.13e-5 SMART
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Ppm1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ppm1f APN 16 16923913 missense probably benign 0.03
IGL00495:Ppm1f APN 16 16910971 missense possibly damaging 0.87
IGL01024:Ppm1f APN 16 16923769 missense probably benign 0.05
IGL02076:Ppm1f APN 16 16914171 missense possibly damaging 0.93
IGL02332:Ppm1f APN 16 16914087 missense possibly damaging 0.72
IGL02422:Ppm1f APN 16 16917716 missense probably damaging 0.99
IGL02936:Ppm1f APN 16 16915236 missense probably damaging 1.00
IGL03118:Ppm1f APN 16 16914078 missense probably null 0.03
R0348:Ppm1f UTSW 16 16903390 start codon destroyed probably null 0.71
R0621:Ppm1f UTSW 16 16915308 missense probably benign 0.00
R0970:Ppm1f UTSW 16 16903593 critical splice donor site probably null
R1785:Ppm1f UTSW 16 16910970 missense probably benign
R1812:Ppm1f UTSW 16 16917787 missense probably damaging 1.00
R1988:Ppm1f UTSW 16 16923666 missense probably damaging 0.98
R3687:Ppm1f UTSW 16 16923883 missense probably damaging 0.96
R5456:Ppm1f UTSW 16 16923746 missense probably damaging 0.99
R7162:Ppm1f UTSW 16 16914193 missense probably damaging 1.00
R7290:Ppm1f UTSW 16 16910955 missense probably benign
R7391:Ppm1f UTSW 16 16914234 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCAGCATCCAGAGAGCTAAC -3'
(R):5'- TCTTTGAAGGGGAGGATCACG -3'

Sequencing Primer
(F):5'- CTAACGGGCTCAGAGGACTAC -3'
(R):5'- CAGAGGGAGAGTCCGGATG -3'
Posted On2014-09-17