Incidental Mutation 'R2080:Amdhd2'
ID229444
Institutional Source Beutler Lab
Gene Symbol Amdhd2
Ensembl Gene ENSMUSG00000036820
Gene Nameamidohydrolase domain containing 2
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R2080 (G1)
Quality Score153
Status Validated
Chromosome17
Chromosomal Location24155833-24163766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24156604 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 370 (T370A)
Ref Sequence ENSEMBL: ENSMUSP00000036141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040735] [ENSMUST00000129523]
Predicted Effect probably benign
Transcript: ENSMUST00000040735
AA Change: T370A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036141
Gene: ENSMUSG00000036820
AA Change: T370A

DomainStartEndE-ValueType
Pfam:Amidohydro_1 62 401 7.2e-18 PFAM
Pfam:Amidohydro_3 327 404 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129523
SMART Domains Protein: ENSMUSP00000120520
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_5 1 71 1.5e-7 PFAM
Pfam:Amidohydro_4 22 176 2.5e-9 PFAM
Pfam:Amidohydro_1 27 134 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132944
Predicted Effect unknown
Transcript: ENSMUST00000138685
AA Change: T45A
SMART Domains Protein: ENSMUSP00000122523
Gene: ENSMUSG00000036820
AA Change: T45A

DomainStartEndE-ValueType
Pfam:Amidohydro_1 5 57 1.1e-7 PFAM
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Amdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Amdhd2 APN 17 24163600 missense probably benign 0.38
IGL01868:Amdhd2 APN 17 24157530 missense probably damaging 1.00
IGL02889:Amdhd2 APN 17 24157787 missense probably damaging 1.00
IGL03127:Amdhd2 APN 17 24157738 critical splice donor site probably null
R0619:Amdhd2 UTSW 17 24156588 missense possibly damaging 0.65
R0759:Amdhd2 UTSW 17 24161613 missense probably benign 0.02
R0970:Amdhd2 UTSW 17 24156570 critical splice donor site probably null
R1657:Amdhd2 UTSW 17 24156055 missense probably damaging 1.00
R1929:Amdhd2 UTSW 17 24157886 unclassified probably null
R2127:Amdhd2 UTSW 17 24158308 critical splice donor site probably null
R2871:Amdhd2 UTSW 17 24157855 unclassified probably benign
R4419:Amdhd2 UTSW 17 24158678 missense probably benign 0.31
R5681:Amdhd2 UTSW 17 24156040 missense probably damaging 1.00
R6315:Amdhd2 UTSW 17 24158356 missense probably benign 0.00
R6413:Amdhd2 UTSW 17 24158316 missense probably damaging 1.00
R7402:Amdhd2 UTSW 17 24161683 missense
Predicted Primers PCR Primer
(F):5'- AGCAAGTGTCGTAGCACATG -3'
(R):5'- CTGCATAATCCTGGGCCATTCC -3'

Sequencing Primer
(F):5'- CATGCTTGTGATCCTACAAGGCAG -3'
(R):5'- GGCCATTCCCAAGCCTAGTC -3'
Posted On2014-09-17